Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34241  (registered. 2012)
Contig Information
Length 784 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|270233745|emb|CBI22354.1|| unnamed protein product [Vitis vinifera]
Score 493
Evalue 1.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34241
GGCTTTCTCGTCCTCCGAGATGCAGATCTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTTGAGGTCGAGTCCTCTGACACGATCGACAACGTCAAG
GCGAAGATCCAGGACAAGGAGGGCATCCCTCCGGACCAGCAGCGCCTCATCTTTGCTGGCAAGCAGCTTGAGGACGGTCGCACCCTCGCTGACTACAACA
TCCAGAAGGAGTCCACCCTCCACCTGGTGCTCCGCCTGCGTGGTGGAATGCAGATCTTCGTCAAGACCCTCACCGGCAAGACCATCACGCTCGAGGTTGA
GTCTTCGGACACCATAGACAACGTCAAGGCGAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGCCTCATCTTTGCTGGGAAGCAGCTTGAG
GACGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACTTGGTGCTCCGCCTGCGTGGTGGGATGCAGATCTTCGTCAAGACCCTCA
CCGGCAAGACCATCACGCTCGAGGTCGAGTCTTCGGACACCATCGACAACGTGAAGGCGAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCG
CCTCATCTTTGCCGGCAAGCAGCTTGAGGACGGCCGCACCCTCGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCCGCCTGCGTGGT
GGGATGCAGATCTTCGTCAAGACCCTCACCGGCAAGACCATCACGCTTGAGGTTGAGTCTTCGGACACCATCGACAACGTGAAG
page-top