Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34239  (registered. 2012)
Contig Information
Length 1165 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig34239
CAGAACTTATAGCTGGTGCATGAAGCATATATGTTACTTCACCCATTATATCCACAGCTAAACCAGAAGGAGTCAACATTTCTATCCACAGATCAAAGCC
ATTTCAAAATTTTGCTCCAAAGACATAAAGAACTTAAACTACAGGTAGTACTGAATAAACAACGTTCACATTCAAGATAGACCGAACAGATAATCTCTTG
CTTCAGGCGGGCAAAACGTCATCTTCACTTGAAAGGGGTGGGGCAGCTTCACTTGCCATCTCCCACGGCTTCAGCCAAGTCATTGACGTGGTCGGTCATG
TCAAGAGCCGGGGAATCATCATCTTCTTTGAAGAGCTTCGAGACGTCCCTGATGGGGTCGTCGTCGTCTTCGAGGAGGGGGGCTTGATGCTGGACCTGGG
GAGGAGGGAGCAGGGGGCCTTGATGCTGGACCTGGAGCGGTGGCAGTGGAGCGTGATACTGGATCTGGGGCAAGGGGCCGTGGTAGGCAGCGAGGTTCTC
CAGTGGATTTGGCACCAGCGCCTCGTTGTCCATCTGGGCGATGGCCTGGACCAGCTGCGGATCATCGATGAACTCAAGGACGGTAGGGTGGCCTGGTGTG
TAGAGGGCCAGGCGGCCTTCTAAGCTCACCAGGAAGGAGAAACGAGGGGGGTTGTTGGCTATCGATGAATTTGGGTCTGGCTATGACCGGAAAACAAATT
GTGCAAGTCAATTTGTTCAGCCGTTAAATCTTCATCCTCCTCTGAACCGCCCACCACCACCGGTCGATCTGTTGCAGCCGTCCGCACTTTTTTCGCGGGC
GAGCCACCACACCCCATCCCCTCTTGCGAGGCTGCTCTCAGTATCCGGAGAGGTCTTAGCTCGACCTCGCCGTCGAGGTTACAGCTCTCATAGCACTGCA
ACATCCATGGGTCACCTTCTTCCTCTACCCGAAATCGACTTACAACATCAAAGAAAATTCAGTCGATTCACATATAACCCATGCTATCACAAAAAAACTC
GATAATGAGCCATGAATCAAAGTATACAATCAGATCTTAAAAAGAGATTTAAGATGCTTGAACTGGAGGCAACGAAAGATAAGGACCTCACCACGTTGTC
CAAGGCTACGTTCCCCAGGAACGAAACATGGCGACCAATCGGCCATGGGGCAAGAGACTCAACGC
page-top