Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34224  (registered. 2012)
Contig Information
Length 2048 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4566505|gb|AAD23382.1|AF102868_1|AF102868_1 beta-D-glucan exohydrolase isoenzyme ExoI [Hordeum vulgare subsp.
Score 556
Evalue 5.00E-156
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34224
GGCAGCCTACTGAGCGGCGGCGGGAGCGTGCCGAGGAAGGGGGCCACGGCCAAGGAGTGGGCGGACATGGTGGACGGCTTCCAGAGGGCCTGCATGTCGA
CGCGGCTCGGCATCCCCATGATCTACGGCATCGACGCCGTGCACGGCAACAACAACGTCTACGGCGCCACCATCTTCCCCCACAACGTCGGCCTCGGCGC
CACCCGGGACCCCGACCTGGTGAAGAGGATCGGCGAGGCCACGGCGCTCGAAGTCAGAGCCACCGGCATCCAGTACGCCTTCGCGCCGTGCATCGCGGTG
TGCAGAGATCCGAGGTGGGGGCGGTGCTACGAGAGCTACAGCGAGGACCGCCGGATCGTGCAGTCCATGACGGAGCTCATCCCGGGCCTGCAGGGCGACG
TCCCCAAGAACTTCACCAGCGGCATGCCTTTCGTCGCCGGAAAGAACAAGGTGGTGGCCTGCGCGAAGCACTTCGTCGGCGACGGCGGCACGGTGAAGGG
CATCAACGAGGACAACACGGTCATCAACCGCGAGGGCCTGATGAACATCCACATGCCGGCCTACTTCGACGCTCTCGCCAAGGGTGTCTCCACCGTCATG
ATCTCCTACTCCAGCTGGAACGGGGTCAAGATGCACGCCAACCAGGATCTGGTCACCGGATACCTCAAGGACACGCTCAAATTCCAGGGCTTCGTGATCT
CAGATTGGATGGGCATTGACAAGCTCACCACCCCTTAGGGCTTGTTTGGATTACCGTTTCTGTCTCAGATACACCTGTAAAAAATACAGGTCGCTGCTCG
TCGTTTCATTTCCGGGTGGAGATCTGCTCATGGCCGGTAAAATACACGTGTAGAATAAATACACCTGTATCAGAATACACCGCATCCAAGCGCGGCCTTA
TGGGGCGGACTACCCCTACTCGGTCAAGGCTTCTGTTCTTGCCGGCCTTGACATGATCATGGTGCCTAAGAACTACACGCAGTTCATCAGCATCCTGACT
GGCTACGTCAACAGCGGAGTAGTCCCGATGAGCAGGATCGACGACGCCGTCACCCGGATCCTCCGCGTCAAGTTCGCCATGGGCCTGTTCGAGAACCCTT
ACGCCGATCCCGCCCTGACCGAGCAGCTAGGCAAGCAGGAGCACAGAGATTTGGCGAGGGAGGCGGTGAGGAAGTCGCTGGTGCTCCTGAAGAATGGCGA
CACGAGCGACGGGCCAATGCTGCCGTTGTCCAAGAAGGCGCCCAAGATCCTCGTCGCCGGCAGCCACGCCGACAACCTGGGCTACCAGTGCGGCGGCTGG
ACGATCGAGTGGCAGGGCGACAGCGGGCGCATCACCGTGGGCACGACCATCCTCGACGCCGTGAGGGCGGCCGTGGACCCGTCGACCACCGTGGTGTTCG
CGGAGAACCCGGACGCGGAGTTCGTCAAGAAGGGCAACTTCTCCTACGCGATCGTGGCGGTGGGCGAGCACCCGTACACGGAGACAGCCGGCGACAACCT
GAACCTGACCATCCCGGAGCCCGGGCTGAGCACCGTGCAGGCGGTGTGCGGCGCGGTGCGGTGCGCGACGGTGCTCATCAGCGGGCGGCCCGTGGTGGCG
CAGCCGCTCCTGGCCGCCGCGGACGCGCTGGTGGCGGCGTGGCTCCCCGGCTCGGAGGGGCAGGGCGTCACCGACGCGCTGTTCGGCGACTACGGGTTCA
CCGGGAGGCTGGCGCGGACGTGGTTCAAGTCGGTGGACCAGCTGCCGATGAACGTGGGCGACGCGCACTACGACCCGCTCTTCCCGCTCGGCTACGGCCT
CACCACCGAGGGGACCTCGCACGAGGACGGGGTAGCGCTGGACAGCAGCATGTGATGGCGGTAAAGAAGCTTGCACATGGACATGGAGGCATGAACCGTG
GACCTTGCTTCCTGCGCGCCATGGCTCTACCGTGGCACTGCGCGAGTTACCATTCTTTATAGAACAAGTTACCATGGTGGTAATATTATTCATCAGCACA
CCATGGTGGTACTTTTCACCAGACGGAGCGGTGTGGTAAATGTATCCT
page-top