Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3421  (registered. 2012)
Contig Information
Length 748 bp
Clones alternative view 72 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 13
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_r Root 1
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 6
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471712|gb|AAW50987.1|| ribosomal protein l34 [Triticum aestivum]
Score 235
Evalue 3.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3421
GACAGCGTTAACTGAGCTAAGCAGCTCAAGAGCATTTTTTTTTTATTTTTTTTTGGAGTCCAAAAGCTCTTGCATCAAAGGCTAAGCATCCATAGAGAAC
CAGCGCGCAAAATCTAGAGAAGCACATCAAACCTCACATACTAGAACCAGGATTCAGCAAATCCGAAGAGAGAAAATTCTTGATTGCTTAAAACAAATTC
GAAGAAACACAAAACATCACCGCGACGCCTATATCGCCCAGTTGTTTAGCTCTTGGTGGTCTTCTCCTTGGTCTTCTGGATCTTCAGCACCTTCTTCACA
ATCTTCTGCTCCTCCACCAAAAACGCCCTGATGATCCTCTCCCTGACTGCAGGACCAGACAGAACACCACCATAAGGACGGTTCACAGTCCTCCTGTTCC
TTGACAATCTGGACCTCTTGTACTCAGTAGGCCTCAGGTGTGGAATTCCTTGGATCTTCTTGCCGGTAACCGGGCATTTTGGCCCACTCGCCCGCTTCTT
GGTGTACTGGTACACAAGCCTCCCACCTGGGGTCTTGACGACGCGAGTCTGGTTCGACTTCGTGGCGTAGCTGTGGCGCTTTCGGTATGTCAGCCGCTGC
ACCATCTCGCCGCCCTCTCCCGGAGTTCTCTCACCGCTCGCTCTTTCGCTCCCGCTGTCTGTAACGAGGCGGATTCGGCACGAGGCTCACTCTTAATGAG
AACTACGACCCCGATGTCCAAACTGACACTGAAACATTCCTTAGTCGA
page-top