Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3420  (registered. 2012)
Contig Information
Length 1475 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 4
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199122|gb|EEC81549.1|| hypothetical protein OsI_24967 [Oryza sativa Indica Group]
Score 637
Evalue 1.00E-180
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3420
GACTCCTCTCCCTCTCTCTCCCCCACCGCACGGACGGAGACAAGCACGCAGGCGAGCAGCTCTCCGGCGACTCGGCGAGGATGGAAATGCTCTTCAGCAG
CCTGTTCTGTGACTCAGCATCATCGGAGAACTTCTCTGGCCATCCGGGTGTTGAGAAATGCCCATTCCTGAGGAACATCAATGGAGCTACAACCTTTTCA
TTTTCTTCTGCTTTGCCTGTGGCTGCTCGAGGAGGCAAGGGCCCCATCTTTGAGGATGGACCAGGCTTTGAGTCGGCATTCAAGCTTTTCCATGGACAGG
ATGGGATAGTTCCCCTTTCAGGAAGATCATATGTGCCTGATGAGTACCACAGTGAGAGCACTGATGTCAAGCCCGAACCTGCCCTTCCCTTTAATCCATT
GGCTGCTAGAGCCGCTACCATAAGCCTATCAGCATTTGGACCATTTGGGTTTAACTTCTTTAATGGCAAGGGCAAAAAGCAGAACAAGAAGCCCAACAAT
CTAGACCAGTCACAGAAGAAGCCTAACAAGCCAGATCAGAATTCCATGAAACAAAAAGGAGGCAACCCACCGTCCCACGAGGCAATGAGTGATGAATGGC
TAGAAAATGGACAGTGCCCACTCGCTCGGTCTTACCGGGCAATGAGTGGTGTTCTGCCCCTTGTCGCCAAGGCACTACAGCCACCAGCTGGTATGAAGCT
GAAGTGTCCGCCTGCAATTGTTGCTGCACGAGCAGCCCTTGCACGCACAACCCTCGTGAAGTCTCTCCGTCCCCAGCCCCTGCCTGCAAAGATGGTAGCC
ATCGCAATGCTCGGGATGGCAGCAAACGTCCCTCTAGGGGTGTGGCGCGAGCACACCAAGAAATTCTCCCCCCAGTGGTTTGCAGCAGTCCATGCCGCCG
TTCCGTTCATTGCGATGCTGAGGAAGTCCGTCAACATGCCCAGGACCGCGATGGTGTTCACCATAGCAGCCTCCATCCTCGGGCAGACCATCGGGTCGAG
GGCTGAGCGCATCCGCCTGAAGACTCTGGCTGCAAAGGGCACCACCAGCCCCGCCACCACAGTCACTATCATGTATCCAGACAAGAGCGGCAGCTGCAGC
GATGCCGAGGGCAAGGTGTGGGATCCTCTTGCGCTGAAGATGCCTGGCTCTGCTAACGCCGGCGCTCCTGCACCAACCCCTAGCATGTGCTTCTAACCGC
GGAATTAGCGGCCAGGTACCGATTTCTATTTATCGTGTATGTAATTGCCTTGCCTGTTCCTAGAAAGCAGAGCTGTTGCGATGTTTTCTGAGGATGAGGC
AAGTGGAATAAGGTGATATAGTACCATGTCCTGTTGTGAACCTGTCATGGTGTAACGTCAGTCCATGCATCTGTCATCTGATGCTGATATATATCTACCC
AGAAACAAAACAATTATATTGTGGTTGTCCTTGAAGCAATTTGTTATGCCGTGTCTGAAACTTTGGTTGTGCAGA
page-top