Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34184  (registered. 2012)
Contig Information
Length 1595 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 11
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115443761|ref|NP_001045660.1|| Os02g0112900 [Oryza sativa (japonica cultivar-group)]
Score 840
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34184
AAAAAAATACAATTTGCGCTCTTTTAGAAAGATAATAGCCTTCTTTTGGCCCAATAAGATAAATATCTTAACAAATTATTTAAAAACACAACACCAAGGG
ATTTATTCCATGCACAAACCAATATCATCGCCGCAACCTTGCCACCATTATTATGCATTGCATATGCTAACTACTCCTTCTTGGCTTTACACTCCGCTAC
TCTTTCCTCTGTGACCTTTAGGGCTTCTCCATATATGCTCACCAGTTTATCAATTTCTTCAAGGGTTATTATCAGTGGTGGGGACATCGCTATCAAGTTC
CCAAGAACCTTAACCACCATACCACGTTTCTTACACTCCGCCCCAAATGTTTCACCTATGCCCCACTCAAAAGGGAATAAATCATATGGTGATTTGTTGT
CAGTGAACTCTGTTGCTATCAGCAATCCTACACCACGCGTCTCCCCAATAATTGGACTTTTGGCTGCAAAGGCCTTGATCCCCTCCTGGAATCTTTGTGC
AACATGTGCTACATGACCAGGAATATCTCTTTCCCGATAAATTTTTAATGCTTCTAAAGCCACAACACATGAAACAGGATGTCCAGAGTATGTAAATCCA
TGAGCAAATGTACCAAGCTTATTGCTATGAGAATAAATTACATCTGATATTTCCCGGCTAACAAGTATTGCTCCAATGGGGGCATATGCAGAAGAAAGAG
CCTTTGCCAAGGAAACAAGATCTGGTTTGATGTCATACAAATCAGATCCAAACATAGCCCCCAACCTTCCAAATCCTGTAATGACCTCATCAACTATGAA
AAGGATGTCATGCTTCTTAACAACTTCTTGAATCTTCTCAAAATATGTTTTTGGAGGCAGGATGACACCACCAGCACCAATCACAGGTTCAGCAATGAAG
GCAGCAATCGTGTCTGGTCCTTCTTTGAGGATAAGATTCTCTAAATTATTGGCAAGTCTAGTTGCAAATTCTTCTTCCGTCTCACCAGGGAGGTGAAAAC
GCCAGTAGTGAGGGCAGTCTGTGTGTAGAACAAAATTTCCTGGCAGATCAAAGTCTTGGTGCAACGTAGGAAGACCAGATAGACTAGCTGATATGTATGT
TGTCCCATGATACGATTGTGATCGTGCAATGATTTTCTTCTTCTTTGGCCTCCCCAATGCATTGTTATAATACCATACTAGCTTGACCTGAGAGTCATTT
GCTTCCGAACCACTGCAGGTAAAGAACACTTTCCCCATTTGCCTGGCAGTGAAAATGCTAATAAGTTCGTTCGCAAGATCCAAAGAGGGTCTTGTTGTAT
GATTATAAAAGGAGTGGTAGAAAGGCAGCTTGTTCAATTGCTCTGTTGCAGCTTTGACTAATCGAGGCTCACTACCACCTAAAGCTGTAGACAATAATCC
TGCAAGGGCATCCAGATACTTGTTTCCGTTGGCATCATAAATATAACAGCCCTCAGATCTCTCGATAATCAATGTCGGCGAGATTGCGGTCTGCCATCCG
GCTGTGAACGGTGCCAGCATGGCATGCTCCTTATCAACCCCATGTNNNNNNCAGAGTCTGACCGTTCGGAAGCCACCTGATCGGCCGAGGCATCT
page-top