Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34130  (registered. 2012)
Contig Information
Length 985 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig34130
TTTTTTTTTTGACGAAAAAGAGATGAACGGAATACAGAGCATCTCCAGGATAATGCACTATTACTAGGACAGCACAGAGGCACCCATTTTATACAGAAAT
ACTGAATACAGACCATGAATATCCGATGATGAACCCCCTAATATTACAACGAGGAGCAAACGACAGTAGAAGCCAGTAGTGTACAATACGTACTTAACCC
AGCCATGAACGACAGTTACAGACATGAACAACATACGATATAATCATAGATAGACATAATACAGTTTATATAAAGGCTACAGCTTATAGCTCGCAGATAG
TGGAATTTATTCAACTTAAACGCGTAAATAGGGCAGGCTGTGCACTTGCTACAGCGCAGCACATACCTCAGGCAACAGCGACGGCAAATTATATTTGGGC
AACTAGGGGTTATTATATCTTGGCCTTTTCTCTTCCCTTGCAACTCACCTTGCTGTCGGCTTGCCGGGTAATGTGACAAAGAATTAGCATCGGAATTGGC
ACTGGCATCAGCATTGTCATAGCTGTAATATATTTGTTTCTGCTTGCACATCCGCTGCTTTGTAAATTTTCTTGTATCAATTCTCTTGTATGTGTCATCC
ATTACTGCTGATAATAAATTCCAATGACACTTTCCTAGCTCCCACTACACATAGTTATCAATGAGCTGTCTTAGTCTGTGCTTGTATTTTCATTACGAAC
AGTTCATCGGTATACTGGTAAACAGAAAAGCAAACATGAACAAGTTCCCTCCTCATTGTTCTTCTGACGTGAACAACTTCTCTACTCTTTATTATTCTGG
CTCTCCAGTCTCTGCACACAATCTTGTCTTGTCTTATTTTCTTGAAGTTATATGAAGGATCTCTGCACTTTGCCAATTTTCTTAAATGAACCGTGAAATG
ATCTCCTTCATCCAGGAGGTGACGTGGTTCCCAGCATCCATACTTCTGCGTCAAGTTGAGAGTAAACCAGCTGCTCTTCGCAAGC
page-top