Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3413  (registered. 2012)
Contig Information
Length 1167 bp
Clones alternative view 129 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_r Root 10
Wh_yd Spikelet at late flowering 12
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 6
Wh_VSCB Liquid cultured tissue 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 8
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 9
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_CA 1
WH_SP 2
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_F/WH_R 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|147826736|emb|CAN70652.1|| hypothetical protein [Vitis vinifera]
Score 266
Evalue 3.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3413
TGCGGTACTAAGCAGCTTATTACAATTTACAATACGGCAATAACAATCGATCAAGCTAAGACTTCTCACATCCCATTATTTTCCTTCTGGGGTCTGAGTA
CCGAACGCAGACCCTATGCTCACATACCTTCTTCATCTTCTGCTGCATGTATCGCAAGCCATACATGTTGTAGTGCTAAGCTTCCTACTATTTGTTGTAC
TACTATAATTTTTTGCCTTCCTTCCACGTGCATTGTCGTGTGCATCAGCGCTTTCTAGCATCCAAAGTCATAGGAAACCAATCCTTGCAGCTCCGGGCCG
TTCAGTCTGCCCTCGTGCCGAATTCGGCACGAGGGTGAACACAAACTTGCATGGCAGAGATACAAATAAACGAGACACAAGGAACATAATAATGGTTCAC
ACAATCACTAATTCTCAGACATAAAATGCAAGGTTCAGATAAGCACCCACCAGGTGGATGATTTAGGACGACCAACGAACAAATGATCCAGCTCTACCAA
CATAGTATGGCACAGAGTACGGCACTGACATATTACTACACACGACAAGTATTAGTAGTTCACGACACATGATAAGCGTTCAGCTGCAAAAGCAGACACA
GATGCCCGCCAGAGCCATTCCCACAGGGAAAGCAAGCATCTTAAGCCCTCTCGCCACGGATCCTCCTAGCCAGCTGAATGTCCTTGGGCATGATGGTCAC
CCGCTTGGCATGGATGGCGCACAGGTTGGTGTCCTCGAAGAGACCCACCAGGTAGGCCTCTGCAGCCTCCTGAAGGGCCAGCACCGCATGGCTCTGGAAG
CGGAGGTCAGTCTTGAAGTCCTGGGCAATCTCCCTAACAAGCCTCTGGAATGGAAGCTTCCTGATGAGCAGCTCCGTGCTCTTCTGGTACTTGCGGATCT
CACGAAGAGCAACAGTTCCAGGGCGGTAACGGTGAGGCTTCTTCACTCCTCCAGTAGTGGGAGCAGACTTACGGGCAGCCTTGGTGGCTAGCTGCTTCCT
TGGAGCCTTTCCTCCAGTGGACTTACGAGCGGTCTGCTTAGTACGAGCCATGAGCAAAACCTTGGTTTACCTCGCGCGCCTCAGAAACCCCAAATTCGCC
GAGAGGGAGAGGTTGCAACTTTCAGGAGACTCGGAGAGCGGCGGTTGGGGAGAGAGAGAGAACTAGT
page-top