Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3411  (registered. 2012)
Contig Information
Length 1377 bp
Clones alternative view 97 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 4
Wh_r Root 7
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 4
WH_XA Root 5
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255671104|dbj|BAF09393.2|| Os02g0625500 [Oryza sativa Japonica Group]
Score 647
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3411
TTTTTTTTTTGAATTCCACTGCATTCAAGCACTATCGTGGTCTGACCACGCTTCCGCATATACTTGGATAAGACGGCCACAAGTAACACCCCATATAATG
GCAACCATGCCTTATACCAAAGATAAAAGGTACCAATTATAGCAGTACAACAGATATCCACGGCCTTAAAATATAGGCCGGATCAGATGGAAAGCCTCAA
AATAATACAGGGAGAACAAGCCGAACCATTAAGTGGTTAAGTGTTGCTTTCCGTACCATCGCCGAATTTGGTTGGTCTAGTTGAAGTCAGGCTTCTCAGG
GTAAGTGCAGCCAGACTGCTGGATGATAACGTTTGCTGCGTAGCAACCGGCCTTTACGCAGTCCTCGATGCTCTTCCCTTGCACCAACTGAGAGAGGAAG
CCTCCAACAAACGCATCACCAGCGCCATTGGTGTCAACAAGCTTCTCCTTGGGCAATAGGATGACAGGGAATGTTTTCACCTTCCCATCCTCGGCCACAA
CTACTGGATCAGCACCCTGAGTAATCACAGCAATCCTCTTTTGTTTTCCAGAAGCCAGAGGCAGTTGTGAGATCTTCAAAGCGATCTCCTCGACATTCTC
AGTCTCCCACCCTCGGACTTTAGAGAAGATCCTTGCCTCAGTTTCATTTCCAAAGATATAGTCCGCATACGGAAGAACCTTCTCTTGGGCATCACGGAAA
AACTCGCAGATAAAGGGAGCGGAGAGGTTCATCAAGAAAACCTTGTTATTGGCAGCAGCATGCTCAGCAACAAGCTGAATAGATTCAGGGGACACCGTAA
GGAAAAAGCCAGCAATGTAGATGTATTTTGCTTTCTCAACTAGTGCCCAGTTCTCTGGCTTCTTTAGATGCTCAGATTTGTAGCAGTTCGCAGCAGATAA
GTTTGCAATCAATGACCTTTCGCCACCAACAACACATACAGCACATGTGCCTGTAGGAGCAGCCTCATCCTCATAGTAATGAGCAGTAACTCCTGCAGCT
TTAGCGGCGCTCTTCATCTCCTCACCATACTTGTCCTTTCCAATGCAACCCATGTAACTTGTTGCACCAGGAGTTTGAAGCATCCATTGGGCAACCCTGA
TAGAGTTCTGCGTGGCTCCTCCAGCAATGTATTCAACATTTTCCTTGCTGGACAACTCATCGTACATGGGCAAGTGCTTGTCCTCGGCGAGAATGGCATT
GTTCGGCTTGACATCATACTTAGCGAGGAAGGCCTCGTCGACGACGGCGGAGATGTCGAGAAGGGGGTTGCCCATCCCCAGGAGCACACCCTCGAGGTTG
CTCGCCGCCATTTTCTTGCTCCTCTCGACGACGGCTGCGCAAGGAGGCGAGAGCGAGATCTGAGGTCTGCGTTGGCG
page-top