Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3407  (registered. 2012)
Contig Information
Length 1035 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218198017|gb|EEC80444.1|| hypothetical protein OsI_22640 [Oryza sativa Indica Group]
Score 335
Evalue 5.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3407
GTAACCCAACCGAAGATCCCACCGCACCTCGCCGTCGGCGGCTCACCGGAGACATGAGTGCCCCGCTACTGCCACCCATGGCGTCCCGCCGCGTCCTCCA
CCTCCTAACGGCATCTCGAGGCATCTCCTCAACCCCACATCTCGCCTCCCTCGGGTGGATCAGCAAGATCAAGAACACCTTCACCGGCAAGAAGGACGCC
GACTCACCCTTCCCCCCGTCCGAATCCTTCAATCTCAACATGTTCGCGGATTCGATGGAGATGGCGAGGAAGGTGGGAACTTTCAAGAACTTCGTGTCAG
GGAGATGCAGCGAGGCCACCGTCGTAGCCGCCTGCGAGAAGCACGCCGCCGTTCTCCGCTACCTCGCCACCATCGACCCAACCGGCGAGAAGCTCAAAAC
CAGTGACAAAATTAGTGCCACCAAGCATTGCAACTGCACAATTGCTGATGTGGAGCACATACTGGCCAAGTACACATGGGCTAAAGATGCCCAAAAGAAG
ATTGAAAAACTCAAAGAAGAAGGAAAGCCAGTGCCAAAGACATTTACTGAGGTGCAAAATCTAATGGGTAATACAGCCTTGGACGTTGGAAGAGCTAATC
TGGCAAAGAGTGGTCAGATAAGTAGGAATGCTCTCTGCCCATGCGGTTCTAAGAAACGATATAAAAAGTGTTGTGGGGCTTCTTGAGGTGAAAACCCATG
CTTTCCTTTTGCTTGCTAGCGCTGACTGGGGCAGAGTTCTGCTCTGCTATGATCAAGAAAAGCACGTCGGGATTCTGAACCTAGACAGCGAGACTGCCTC
AGTGGCTGAAAGGGCCAAGCTTAGTTGTCGCAAACCTGGCTGCGAAACTTGTAAAGCGCCATAAGCGGCTCTGTACTATGGGATAAACATTTTCCTAAAC
CCTGTGATGTCTGGCCTTAGTTAATTTGATTTGCGTATGCAGACAGTTCAAAGCATCCGCGGGCATGGAAGCCTGATGTTTCAACCTTCCTATTGGTCAG
TTTATTGAAGCTCTATGTACATTGAGGAGCTGATA
page-top