Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34037  (registered. 2012)
Contig Information
Length 987 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081739|ref|XP_002445638.1|| hypothetical protein SORBIDRAFT_07g023200 [Sorghum bicolor]
Score 480
Evalue 9.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34037
CAGAAGAGCAGCTAAGGCACCCGTAAAGAGGATCTTTGGTTTAGCAGCTCTCCTGTAAGTTCGTACTACCTAGCTGAAGAAGCTCGGGGGCACCGGCCGG
TCGGAGGACCCCAGCATGTCGCCCGTGCACGTCCCGGAGCTCAGCAGCGGCGGGTCGGGGTCGGGGTCGCTCACCCTGAACCCCGTGCAGCGCGCGCTCA
GCCGGCTGTCGTCGTCGTCGGCCCTCACGCCCAGGTCGCCCCCGCCGTCCTACGGGAGCATCGTCACCGTGCTCAGCATCGACGGCGGCGGCGTCCGCGG
CATAATCCCCGGAACCATCCTCGCCTTCCTCGAAGAGAAGCTCCAGGAGCTCGATGGGCCGGACGTGAGGATCGCCGACTACTTCGACGTGATCGCCGGG
ACAAGCACCGGGGGCCTGGTGACGGCCATGCTCACGGCGCCCGACGCCAAAGGACGCCCGCTCTTCGCCGCCAAGGACATCAACAACTTCTACCTGGAGC
ACTGCCCGAAGATCTTCCCCGCCGGCTACGGCGGGCCTCTGGGCTTGCTCAGGAGCATGAGGGGGCCCAAGTACGACGGCCAGTACCTCCACTCCGTCGT
CAAAGAGCTGCTCGGCGAGACGCGGGTCGGCGAGGCGCTGCAGAACATAGTCATCCCCACCTTCGACATCAAGCTGCTCCAGCCAACCATCTTCTCCCGA
TACGACGCCCGCAACGACGTCTCCAAGAACGCTCTTCTGTCCGACGTCTGCATCAGCACGTCGGCGGCGCCTACTTACCTCCCCGGCCACCAGTTCGAGA
CCAAGGACAAGGATGGCAGGCCCCGGGCCTTCAATCTCATCGACNNNNNNGTTGCCGCAAACAATCCGACAATGTTGGCCATGACGGACGTGAGCAAGCA
GATCCTGCTGGGCAACCAGGACTTCTTCCCGATCAAGCCCGCCGACTACGGCAAATTCATGGTGCTCTCCCTCGGCACCGGCTCCGC
page-top