Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34015  (registered. 2012)
Contig Information
Length 1120 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 9
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 13
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|232196|sp|P30110.1|GSTF1_WHEAT|GSTF1_WHEAT RecName: Full=Glutathione S-transferase 1; AltName: Full=GST
Score 467
Evalue 1.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34015
ACGGGCACACATGTGCCAGTTATCCCTGTCCATATATATTTGCATGCAATTGCACACGTATCCAAGATGTATATATATACTGATCTCTAGTGGGGTACTA
CTATATAGGACGTACAGTACGGATTAGCAACATTGACCAGTCCGTTGTTTATTTACTAACTAGTACTAGTGCATAAATTAAAGCAAGGAATCCAGCGCAC
GAACAGAAGCGCAAGTGGACTCCTCGTGCTGCTGAAACTGAAAGCGTATACTACTGGAAGTAGACGGGCAGATGATCACCCACCCACGGGAGGGAGGTCT
CTTCTCTTGAACGGAATCATCACCGGCACGGCACGGCACGGCACGGCACACACCCGCGCGGAGTGCATAAACACCTAGTACTGCGCACCTAGCTTAAACT
CGGTAGGCATATGCTTGCAGACCCTCTGCACCGCCGGCCTCGCCATGAGCATCTCCCACCAGGCCTTCACCTTGGGGTAGTCATCAAACACCTTGGCGTA
CGGGGTGGTCATGAAGTAGAAGGTGAACGGGATGTGGTTCAGATCGGCGAAGCTGATGGAGTCCCCGGCCAAGTACCTGCTCTTCTCCAGCCGGGCCTCG
TAGATCCCCAGCACACCCCTCAGCCGCTCCAGGCTCTCGTCCACGACGGTCTGGTTCGGCGCCGCGCCACCGCCAGGGATGATGAAGGGGATGATGATGC
ACTCGAACACCACGGGCGAGATGGCCGGGTAGTACTGCTGGGCCTCCACCTCCGTCCACACGTCCACCATTGCTAATTCTTCGATTCCGCTGTTTTCTCC
GAGGAGGTCCAGGCCGGCTGTCCCCCCGTACTTGCGGAGGATGTACTTGGCGATGGCGCGCGACTCGAACAGGACGAGATCGCCATCTTGGAACCCAGGC
ATCTTCGCAAACGGGTTTAGCTGGACGTGTTGGGGCCTCTTGTGCTCGCCGGCGACGAAGTCCATGGGCACGAGCTCGTACTCGGCGCCGACCTCCTCCA
GGAAGAGCAGCACCCGTGCGACGTTTGTCAACATCGGGTGCCCGAACACCTTCACCGGAGACATGTTTGTCCGTGAACTTCACGTGATGGATGCTCTACA
GGAAGGCAGGAGAGGGCAGA
page-top