Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig340  (registered. 2012)
Contig Information
Length 1061 bp
Clones alternative view 87 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 14
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_SH - 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_RDr Root of dessiccated seed 4
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 5
WH_XA Root 11
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242070913|ref|XP_002450733.1|| hypothetical protein SORBIDRAFT_05g016477 [Sorghum bicolor]
Score 187
Evalue 2.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig340
TTTTTTTTTTAAGGGCCAAATCATCAGCATAACATTAAGCAACAAGACATTTTTTTTTTATCAAGCATTCAACACAGATTAAACTCAAAAACATGTTCAC
AAGAAACCAGGCCAAGTGACATCAAGTCTTAGCTTCCATAGTAGCAACTGAAACCAACCAGAGACATCCAAGAGCTAGGTAGACATGGGAAGGAAACAAG
TTCCAGGTAAAACTACTAGCAACATCTAGAGCTGCTTGATCTCAGCCTTCCTCTTCTGCCACAGCCTGTCGAGGGAGCCATCAGCATCACCCTGAGCACG
GACGAACCCAGAGAGAGCAAAGGTGGTGAAGCGGCCATCATAGAGGCCATTCTCATCAACATGACCAATGTTGATCTGGACAGAGGCGTGGTCCTTGGCC
GTGATGATCCTGTTGGTGGCCGAGCACTTCCTGGGGACGTAGAGGTCCACCATGTCACCCACCTCGTTCTGCATGGTGGCGGCTGGAAACAGCGACTTGA
TCTCTTGGATTCGATGAGGCTGCGGGAGGACGAAGAGAAGCTGGTGCCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCT
GACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGA
ACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGAAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAG
ACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCGCATGGTTTTCAACTTTTCATTCATGTTTCTGAATCGATAG
ATTGGTTGATTGCCTTGCCACGCTGGCTCTGCGCGCGTACGTCCGTGCGTGCAGGAACTGTACAACAACGTCGGCTCTCCGGCCGGCAACCTTTGTAATG
TGTAAAGCTTAACTAGCGGCCACTGTTGTGAATGCATCCATATGATCTGTATAAACTCTTT
page-top