Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33988  (registered. 2012)
Contig Information
Length 1214 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222635641|gb|EEE65773.1|| hypothetical protein OsJ_21455 [Oryza sativa Japonica Group]
Score 498
Evalue 5.00E-139
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33988
ATCGAAGTCATGGGCAAAAACGTCTTATGTTGCCAGAAATCCTCAGGAAACGTGGCAACAAACCTCAGCCTCAAGAGTTGATGTTTGCGTAACCACATCA
AACATGAAATGGCCGTAACCTCTCGGGGCTCAGCTCCCAAATTAAGGAGGAAAAAACGCCGTGGAGTTGCCAACTCTCTTATTAATTTACAAAACTGGTT
GCTTATGCGCTGGTGATCAAGCAACTGAAACTAAATTTGCACCTAGTGTCTTTTCTTGGGCCACCTCCAAAGAATTCTTGGAAACACGATAACACAGCAC
CTTTCATTTACAAAAGCAGCCTCCTGATGTCGCTGAAGTTCAATGCCAGCTCCGTGAAAAACTTGCCTCCTACTTGCCCATCAAATATACGATGATCAGC
AGACAGTGTCAGCATCATTTTCGTTACTACAGCAGCCTTCTCTGTTCCGTCATTGTCCATCACAGGCTCCACAACCTTGTTACCCCGACCAACAGCGAGA
ATGCCAGCCTGCGGAGGATTAATGATAGCACAGAAGTGGTCCACCGGATACATTCCTAGATTTGAGATACTGAAAGTACCCCCCTGGAACTCATTAGGAG
CAAGCTTCCCAGCACGTGCCTTTTCGGCTAGCTGTTTGACCTCTGAAGATATTGCTGATATAGTCTTTTGATCCGCGTTTCTTATTATAGGAGTCATCAG
GCCCTTCTCTGTAGCAACAGCAATAGATATATCCACTGAATCACACTTCTGGGCTTCTTCCTTCAAATTGTCCCAGTAAGCATTTGCTTCAGGAACGTTC
CTTAAGGCAAGTGCCACAGCTTTTATGACAATATCATTTACTGAAACTTTAACACCGTGTTGCTCTTTGAGTTCATTCCTGAATGCGAGTAAGGGATCCA
GTATAACATCTTTGGATAGGTACAAATGCGGAGTAGTCTGTTTGGATTCAAGCAACCTTTTTGCAATCACCTTGCGTATCTGAGTATTGGTTATATCTTC
AAATGTGCCGCTCTTTGGTGAAGTTGTCTGAGAGTGAACTTGGGAATCACGAGCTGGTTGGGGCGAAGGTGCAGCTGGAGCTGTCTTTTCTTTGGCTGAA
CTTAAAGCAGTGCCTGACTTCAACGCAGCCAAAACATCACCTTTCAGAAGGGTGCCACGGGGACCTGATGCCTTCAGTAAAGAGGCATTAAGACCATGTT
CTTTGATCAGCATC
page-top