Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33929  (registered. 2012)
Contig Information
Length 1464 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212274375|ref|NP_001130208.1|| hypothetical protein LOC100191302 [Zea mays]
Score 408
Evalue 3.00E-178
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33929
CGGGCAGGCATCTTCCTCCGAGGCGCGGCGAGGGGAGGTAGTCGCCGTCGTCGCCGCCGCGCGCGATCCGGGAGGGCGAGAGGGGAGATGGCATCGGAGG
ACGTGGTGGGGAAGAGCAGGGGCGACACGGCCGTCAACACCATCGTCAACCTGGCCGAGGAGGCCAAGCTCGCGCGCGAGGGCGTCAAGGGCCCCGGCCA
CCAGGTCCTCACCGTCTGCAAGTCCCTCTTCGCCGGAGGCGTCGCCGGTGGCCTATCGAGGACTGCTGTTGCTCCGCTTGAGCGATTGAAGATCCTGCTT
CAGGTTCAAAATCCTCACAGTATCAAGTACAATGGTACCGTTCAAGGGCTTAAGTATATATGGAGAACAGAAGGCCTTCGTGGACTGTTTAAGGGCAATG
GAACTAACTGTGCAAGGATTGTCCCAAACTCTGCTGTGAAATTCTTCAGCTATGAGCAAGCATCAAGAACTTATCTCTGTTGCACGATGAGACAGTTTTG
ACCTGAAATTGGGGTATTTTGTATCTGTACCGGCAACAGACTGGGGATGAGAATGCTCAGCTTAGTCCAATCTTGCGCCTTGGAGCCGGAGCCACAGCTG
GTATCATAGCCATGTCTGCCACTTATCCCATGGATATGGTTAGGGGTAGGATTACTGTTCAGACAGAGAAGTCTCCCTACCAGTACCGTGGTATGTTTCA
TGCATTGGGCACAGTGTACCGTGAANNNNNCTTCCGTGCTTTATACAGAGGCTGGCTTCCATCAGTGANNNGAGTTGTCCCTTATGTTGGCCTTAACTTT
GCTGTGTACGAGTCTCTGAAGGACTGGCNNNNCCGGTCAAATGCATTCGATCTTGCAAAGGACAATGAGCTGCACGTAGTAACAAGGCTTGGATGCGGAG
CTGTGGCTGGAACCATAGGCCAGACTGTGGCATACCCTCTTGATGTTGTGAGGAGAAGGATGCAGATGGTCGGCTGGAGTCACGCTGCTTCTATTGTTAC
TGGAGAAGGCAAAGAGGCACTCCAGTACAATGGTATGATTGATGCATTCAGGAAAACTGTTCGCCACGAAGGATTTGGTGCTCTGTACAAGGGTCTTGTG
CCCAACTCGGTCAAGGTGGTGCCTTCCATCGCCATCGCGTTTGTGACGTACGAGGCCGTGAAGGATGTTCTAGGAGTAGAGATGAGGATAGACTGAAGAA
TCGGACCTAGCGCTGTCCGTGTTATCAAACTTCTATTTTTGTAGGTGTTCGAGTTCCCTTTTTTTGTTGTTAGGCAGGGCAAGTAGAAGGACAATATAGG
ACCCGAGGCTCCATTCAGCATAAGGCCCTCTCAGCCCTTGTCGATATATCCTACTACTGGCTCCGGAACCCTAATTGCTCTCGCTTCGGAACGTAATAAG
TTGGCTGTAAAGCATTTAAAAGCATTTGCCTGACTCATAAAGTCTTATTCAGTGAGGAACCTTG
page-top