Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig339  (registered. 2012)
Contig Information
Length 784 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_SH - 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 6
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222613028|gb|EEE51160.1|| hypothetical protein OsJ_31927 [Oryza sativa Japonica Group]
Score 305
Evalue 3.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig339
CCATGGACAAAACAATAGCACAGTTATGATGAAGGTACATAGGGTTGGGAGTGAAACATTTTAAAGACACGATTTGAGAATGAGGGCAACCAAAAGAGGC
ATGTATTTTGATGCAAAATTCCACCAACATATCAGACGAAACTCGCGTACATGACAAAACCGGTCCACTGGCACAAATAAGGTAGGTCAGAATTCTTGAA
AGGGGAGGTGGTCTCTAATGGCGCCGCTTAACTTATAACCCTTCACAACAGTAAACATGCATCAAAATCACGACTCTGCCTTTTTCTCTTCAGCGGCCTC
TTCAAATGTCTCTCCAGGGACAAGCTCAGGAACATCATCATCGTCGTCAGCCTGAGCAGCACCTGCACTGGCACCAGCCTCGATGCCAGCAGCACCACCG
GGGACCTGCTTTTGGAATTGCTCTGCAAGCCTCCGCAGGTTGTCCAAGTTGTCAGGACCAAGTTGATTGATAATTGATGGCAGCAGATCTTGCAGTTTCT
TTGTCTGTGGAGTTCCACTGACCACCCATGTATTAGCACCAATCGAAGCTTGCACTTTAGGATTGAGAAACTGAATAACCACATCATCCTTAAAGATGTT
GACCTCTTCGATACCAGGGATGGTGTTCACTCCTACTCTTTTCAGCGTACTCTGGAGCCTTTTGTCATCTGTAGTTGTGGTCTTGTGTACAGCCTTCTTC
TTCCTGCGCATGCTACCCTTCCCTCCGGTGCGCACGGCACCTGCCATCTTCTTGAGCTTTTCAACATTCATCTTGGCTGGGGGG
page-top