Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3387  (registered. 2012)
Contig Information
Length 805 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XE Seedling, infected with leaf rust 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3387
ATACTAGATACTACTAGTACTCGATAGATTATCAGTCTCACAGCATGACATTGCTTCATCGGTGCGCAACAATAGCATCAGGGTAGGCGGATCAATCCCA
CATATATATATGTCCACAGGATCAACTAGAAATATATAGATAGATAAGATAGATACATGGTTGGTACTAGATGGGATAGGATTGGCGAAGCTCCTCGTCA
GCTTCTCAGACCACAAGAGCAAGAGCACCGTCATGGATGGGATTAGGCCCCCACCAAGAAAGGCCAGCGAGCGTTGTTGGCCTGAACGCGGCGCTCATAC
CGCGACATGACCCTGCCGTCGCTGCCGATGGCGTCGTCCTGCGAGTGGTAGCCGTCCGACACATCCCCATCCGAGTAATCCACTTGGTCCGTCGGTGGCT
TGGTGGACTCGATCCACGCCAGGAACGCTGCCCCCTCCTCATCCCGCTCCAACTCCACCTTCCTCTTGGAGCCACACTTCTCCGCCTCCTTCTCCGCCTC
CGCCTTGGCGTCGAGGAAGTCCTCCTCCTTCTCCAGCAGCGCCACGAACTTGATGAGCGCCTCCTCCTCCTCCTTGGTGAGGGTCCTCAACTCCACCTTG
GCCTTGACCTCCTTTGACTTGGCCTCGACCTCCGGCTTGGCCTCCTTCGCCTTGGCCTCCTTTGCCTTGGCCTCGACCTCCGGCTTGGCCTCCTTTGCCT
TGGCCTCGACCTCCGGCTTGGCCTCCTTCGCCTTGGCCTTCTTCACCTTGGCCTTGACCTCCGGCTTGGCCTTCTCCTCCTTGGCCTTGGCCTCCTTGAC
CTCCG
page-top