Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33862  (registered. 2012)
Contig Information
Length 916 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 8
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 8
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig33862
CCGGGGCGTGAGGAAGTAGGGTCCATAATACAAAGGCAGGAAAACGAACGTGCGCAGCGCAAGGGTCGCCGGCGGTGCGGCGAGGGCTTGCTGCGACCTT
GGTTCAACGAGCGGACTTGCGATGCCGCTCGCCGGCGGCGGATGCTGGCTGCTGCAAGCCGGACGGCGAGTGCGGCGGGCGGCTGTTCGTGCGTGCCAAC
GGCGAGGATGCTGCGTCGTTCGCGCCGCGGGCGGTGCTTCCACGGAGAGGGGAGACGAGCATGATCCGTCACACGACGACGGCGTACGGGCGTCGCATCT
GACGGCCGCGGAGCTGGCAGCCCTTCGGCGCCTCCCGCCAGGACAGGCTCCCGCCGCGCGCCGCACACCGACGGCCACCTCGGTGGTCGACGGCCAGCCG
CCGCGTGCTCCCGTCGGGTCCAACCGCCGCGGCCTTCACACGCCCAGGACCAGGTGCGGCGAAGACTGTTGCTCCCGCCTCAACTACGATCAAAACGTGG
CCGCGAGGGACGGCCAAGGAGCCTACGTCCGCCGCCGCCGCCAAAACTACGGCACATATGCTGCTGCTGGGTTGGATAGCGATTGCAGCCGCGTCCAAGA
ACTGAGTCGCCAATACCGCCACATACGTCCGACCGGGTGGGACGACGACGATGGTTATCGCGGCGCCCGCATATCGGATCGGTCGACAATACCACAACAA
AATTCTGGCCGAGTGGGATGGCAACGGCCGGCGCGCCCGCTTATCCGAGAACCAACACCATGACAAATATGCGACTACATAGGATGGCGATGGCTCTTGT
ATCCGTGTATTCAAAAGTGCTATTGTCAAAGTATTGAATTTGAGAGCATGATGTTAATTTGTACAACACTCGTATTGAATTGATCCAAGTTGTTTGTTAT
ACTTAGAAAAAAAAAA
page-top