Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33849  (registered. 2012)
Contig Information
Length 724 bp
Clones alternative view 94 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 19
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 15
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 18
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig33849
CCGGGGTGGTAGTGAAACATACACACCGGATCACGGATCAGCAGCGGAGAAAAGCTGAGTTTTACGTGAGCTGAAGAAACCTTGATCAGAGTGAGCTGAG
AGAGCAGAGGGAAGAAAGGAAGAAGGGGAAAAGATAGTGCAGCAGTAGCTTTAGCAGGGCAGCCATGGGATTCTGTCGTGGGCCTTCCGATGTCAAGGTG
CTCCCAAAGAACACCTCCTGCTTGTCGTCAACGTCCTCCTCATCGTCATCGCCTGCTAAAGATTCGGGCGACGGTGGCAAGAAGAAGCAGCAGCAAGGTG
TGAAGAAGGAGCAGGGGAGGGAGAAGAAGAAGAGCAACCTTGATCGGGCCGCCATGGCTACGCCCCGCCTCCCCTTCCATTCTCGACCCGGTCTCATGTA
ATGTTAACCGGGAACAACAATGCATGCATAAGATCCCGTATGTTCTCCAATTAGCTTATGGCTAAGGTTGGAGCTTGGGTTTAAATAGCTTCTGTTGTTA
GGTTAAAGTTTTGAGATTTCTACTGTCGTCACTTGTTGTATTTTTTCATTGATTGGTTGGTTGTATTCCATGATTCAAATTCCTGGTGTTTTCTGTCAAT
TTACAAGAGATTAAGCTCATTATCACCAAAAAAAAAATTGTTTCCCTACTTCCTTCGTTGGATTACTATTCCCCTACATGACTCGCTAGTTTAGGCAAGC
AAGACTAAGCCTACAAAAAAAAAA
page-top