Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33843  (registered. 2012)
Contig Information
Length 897 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 9
Wh_VWD Shoot grown with dessication 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XV Leaves, plant was grown at constant 23 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195608510|gb|ACG26085.1|| photosystem II reaction center W protein [Zea mays]
Score 219
Evalue 3.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33843
TATGGCCAAAATGCCACATACCATCACAGATCAGCAATTTTACTGAGAACTTGGACCTTTTTTTTTTTGCGTGAAATTTTCCTTGGATGTTTTATTCATT
CAAATCGCGGGACGCACGGTCTTCAAGGCGGGGCAAGCAATCCATCTGACCGCGAAACATCTCTCAGAATGGAAACGCTTAGATACAAATATCCATCTCT
GGAATTACATTACACCGATCATGGCGATGCTCGCGAGCGGATTACATGAGACGACGGGAGAAACTATGTGTAGCTTAGAGGGAGAGGCCGCCGGACTCCT
CGTCCTCGTCGAGGCCGGAGGTGTAGACGGTGTAGAGCGACCAGATGAGGCCGAAGACGCCCAGGAGGATCCACCCCAGCAGGTTGTTGCTCAGCCCCAG
GCTCAGCCCGGTGCCCTCCGTCGACATCCGCTCGTCGACCAGAGCGAGCGCCGGCCCCGCGGACGCGGTCACCGCGCCCGCCGCGGCGAGCAGGGACGCG
CTGGCCCCGCGGACGGTGGCGGCAGGGGTCGCCTCCTTGGCGTCCTTGGAGTAGCTGCACCTCACCCTCTCGCTCCTCGTCCTCAGCTGGGGCAGACCTA
GGGCCTGTGGCCTGGCGATCGCGGCACGGGCGACGACGGTGGTCGCCGCGGCGGCGCTGATGGTGGCCATTTGTTGCTGTGCTGCGCTGCTTTGCCGCCG
GCCTCTGCTGGTGCTGGAGAGTGTGGCTTGCTCGGGTCTTGCAATCACGGTGGTGGCGCTGGTGCTAGCTGGGCTCGTNNNACTGTGAGCGAGCAGTGAG
CGCGTACGTGCCATGGANNGGGAGGAGAAGCCGGTGGTGGGCGGGGCCTACTGGGGCGTGGGCGCGAGGGCCTGCGACTCGTGCGCCACCGAGGCGG
page-top