Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig338  (registered. 2012)
Contig Information
Length 1358 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115472913|ref|NP_001060055.1|| Os07g0572000 [Oryza sativa (japonica cultivar-group)]
Score 585
Evalue 6.00E-165
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig338
ACTGAATCTTACTGATGACATATGTTTATCCATTAACCCTAAAAACTGCCAGCATTGCAATGCTTTTATTAACTGCCGGTCGCACTGCAATCTCGTGAAC
AAAGAGGTCCAAATCTGGCACCTTACAGCAGCCGTCGGGCACCAAACAAACACATCTCAACATTAGGAGACCAACTCATCTGTTGAGACTCGGAACCTCG
AAGAGGAACAACTCGTATTAAAACAAAGCAGTGCAAGCCTAAGTTAAGTAAAACCTCCAGGTTGACATACCACCAGGAGCGGCCCATGGAACACAGCAGC
AAGTTTCTCTTTGAGATGCCACTTGCTGCTGCATAGGTTCGTTCTACATAGAGTACACACAGGTCTACCTATCCTCTCCTCTGCATATTCATCAGCCATC
TTGGACCCAGAGTCTCACAGTCTTGTCATTATCAAGGCTGCCAGAAGCAATTTTGTTCTCTGTTGGATGACATGACACCGAGATGACAGCGTCGGTATGG
CCTTCCATTTTCTGAAGAATGTTTTTCCCTTGGAGGTCCCATATGTATATGCATTTATCTTCCGACCCACTAACAATGTACTTCCCGTTCGTGACGGAAA
ACGCAGACTGGATGCAGTATGCTCTGTTCACATGTCCACTATATACCTTCAAGAACTTGCCAGTAGCATAGTTGCATAGTTTCAGTGAGTCATCGAGCGT
AGCGACGAGGATGAACTTGCCATTCGGTGAGAACATTGAGCAGGAAACCGCTGGCTTCTTGTCGTCGTCAATGACTGTCTTGAGACAAGAGCCAGTTCCC
GCATCCCAAATCTTGCAGCTCCCATCATGGCTCCCTGACACAATGATCGATCCGTCCCGGATGAAGTGGACGGAGGTGACGGGCTCAGAGTGCGCGTCGA
TGGTGCGGATGCAGCGGCCGCTGCTGACGTCCCAGATGCGCACGGTGCAGTCGAACCCCCCCGAGGCGACCTGGGAGCTGGTCTGCGGATTGGAGTTGGC
ACTGAAGACGAAGTTTGTGTGGCCCTTGAGCACGCGGATGCAGCGATCGGCGTTGGGGTCGGCGGGCTTGGGGCCGGAGAGGATGGATCGGATGTCCCAG
ATGCGGAGGGTGCGGTCGTCGGACGCGGAGCAGAGGTAATTCGAGTCCGTGCTCCAGGACAGGTCGGAGACGCCCTGGGTGTGGCCGCGCAGGTTGGCGA
TGACGGCGAGCGAGGACGGGGAGAGGAGGGCGACCGTGCCGTCGAGGGAGGCCGTCGCTAGGAGGCGCCCGCAGGGGGAGAACCGCACGCAGGAGATGGC
GCGGGTGTGCGGGGTCGCCGCGCGCACCTGCCGGTATGGCCGGTACGGCGGCGCCGCC
page-top