Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33793  (registered. 2012)
Contig Information
Length 818 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226504044|ref|NP_001147451.1|| amidophosphoribosyltransferase [Zea mays]
Score 286
Evalue 2.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33793
ACGCGGCGCTCGGCTTCGCGCAGGCCTCGGGGCTCGAGTTCCAGCAGGGCCTCATCCGGTCGCATTACACGGGCCGCAGCTTCATCCAGCCGACGCAGGC
GATCCGCGACCTCGCCGTCAAGCTCAAGCTCGCGCCGGTGCGCGGCGTCATCACGGGCAAGAGCGTGGTGGTCGTGGACGACTCGATAGTGCGCGGCACC
ACGTCGAGCAAGATCGTGCGCCTGCTCCGCGACGCCGGGGCGCGCGAGGTGCACATGCGCATCTCCAGTCCGCCGGTCGTCGGCCGGTGCCACTACGGCA
TCGACACGCCCGACGAGAAGGAGCTGATATCCAACAGGCTGGACATCGAGGGCGTGCGCGAGATGATCGGCTGCGACTCGCTCGGCTTCCTGACGCTGGA
CAAGCTGCACAGCATCTACGGCGACGAGGCGGACGAGCTCTGCGACGCCTGCTTCTCGCGGAACTACCCGGTGCCTATGCCGGAGAAGGTGCCGGCGATG
GCATCCGCCGATGATGAAGACTGACCAGAATGTGCGACTAGGGAACGGCATCCGCATCTGTACTCCGCATGCTTCTATAGGATTTTGGGCGTGGCGAACC
GTGTCGTGGCAATTGCATTCATCATCTGAATTTTTGCAGGTCTTAAGTTTGTATCGCTGAGCGGCTAGCGTTCCATGGCCTCTCAAATTCGAGGTTTCTA
AACCTTTTTCTTGAGTCAATTTATATACTGTAAGAAAGGTTGACAAGTCAGACATCTAATATTGTTTCGTCGTCGACGTGAATTGCTAATGAATTGCATT
TTGCAAGTAAAAAAAAAA
page-top