Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3376  (registered. 2012)
Contig Information
Length 706 bp
Clones alternative view 71 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 3
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 4
WH_XA Root 9
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400871|gb|AAP80667.1|AF479048_1|AF479048_1 ribosomal Pr 117 [Triticum aestivum]
Score 281
Evalue 4.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3376
TTTTTTTTTTGATGCAAGTTTTTTGTATGAATACTCCCCATAAACTCATCATGCCAAACCAAAACAGAGATACGCAAAGTTCACCATTTTCTCTGGCAAC
GAAGTTACAGTTGTTAAACTAAGCAGACAGGCAGGCTTCTGTTCACTAAGAAACTGAGATGCCAAACAAAACAGAGCAACGCAGAGTTCCACTATTTCCC
AGGCAAAACAGCTGCAACCCACACTGGCATTATATAAGCAGTCTCACAACTTGAAACAGGCTCTCAAACGATGGCATTGGCGTTGCTGGCGATCCTGGGC
CAAAGGTCAGCACACTCCTTTCCCACAGGTCCGGTGATGGCAGATCCTTTCATCTCACCCTTGGGGTTCACGATCACTCCAGCATTGTCTTCGAAGTACA
TGAAGACGCCGTCCTTGCGGCGCCAGGGCTTGCGTTGGCGGATGATGACGGCGGGCATGACCTTCTTCCGGAGGTCGGGCTTGCCCTTCTTGACGGTGGC
CATGACCATGTCGCCGACGCAGGCGGACGGGAGGCGGTTGAGGCGGCCCTTGATGCCCTTGACGGAGATGATGTAGAGGTTCTTGGCGCCCGTGTTGTCG
GCGCAGTTCACCGTCGCCGCCACAGGCAGCCCCAGCGACATCCGGAACTTGTTCCCCGCGGAGCCTCCCCTCCCTCGCTTCGACATGGCGGCGGCTGCCC
TCGTGC
page-top