Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33734  (registered. 2012)
Contig Information
Length 1300 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|61658228|gb|AAX49503.1|| UDP-D-glucose epimerase 3 [Hordeum vulgare]
Score 735
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33734
GACCAAAATTCTGTGGCAAGCACCAGCCCGGCCGAGTGAGAGTCCAGTCTAACCCACCCAACTCAAGTTCCATCTTACGAATAATACTACAACAGGAAAC
ATTTTCTGGGCACACTTTAACGCCCTGGGCTTATTGACAACATCTTTCTTTCACGCTACAAGGCTCCCGATGGGCCACCGAATCAGTCTTTGTTTTCAGC
GTTTCCGCAGTAGCCATAGGGGTTCTTCTTGGCCCAGTTCCACTGGTCCCTGCACATCTCCTCGATCCCGTACTTGGCCCTCCAGCCGAGCTCCTCTTCG
GCCTTGGCGGTGGACGCGTACACCTGCTCCGAATCGCCCGGCCTCCTGGGGCACATCTTCACCGGGATTTTCTTGCCGTATGCCTTCTCGAACGCGCTCA
CCATCTCCAGCACCGTCGTCCCGCGCCCCGTCCCCAGGTTGTACGCCACACAGCCGATGTCAGGGGTGGCGAAGAGCTTCTCGAGCGCCGCGATGTGGCC
GTCGGCGAGGTCGACCACGTGGATGTAGTCCCTGACGGCGGTGCCGTCCCGGGTGCGGTAGTCGTGGCCGTAGACGTTGAGCTCGGGGCGGCGGCCGACG
GCCACCTGCTGGATGTAGGGGAGCAGGTTGTTGGGGACGCCCTTGGGGTCCTCCCCGATGTCGCCGCTCTCGTGGGCGCCGATGGGGTTGAAGTAGCGCA
GCAGGATCGTCCTCCACTCCGGGTTCGCGTGCTGGTAGTCGCGCAGCATCTCCTCCAGGTACAGCTTGGTCCTGCCGTACGGGTTGAGGGCCTTGAGGGG
GGAGTCCTCGAAGCAGGGCACCTTCTCCGGCTGGCCGTACACGGTCGCCGACGACGAGAACACCAACTTGTTGCATCCGTGCTTCTTCATGACGTCGTAT
AGGTTGACGGTGCCGACGATGTTGTTGCGGTTGTACATCTCCGGGTGCGCCACGCTCTCCGCCACCGCCTTCAGCCCGGCGAAGTGTATCACGGCGTCGT
ACCTCTTGGCGGCGAACACCTTCTCGAGGTCATCCTTGATCGTCAGGTCCCCGAAGATGAATTGGAGGCGGGCGGAGAGGGCGGGGCCGACGATGTGGCG
GACGCGGTCGAGCGCCTCGGGGACGGAGTTGTGGAAGTTATCCACCACGGTGACGGCGTAGCCCTTCTCCAGCAGCTGCAGCACGGTGTGGGTGCCGATG
AACCCCGCGCCGCCCGTCACCAGCACGCTCCTCCCCTGCGCCTCGGCGCCCCCAGCCCCGCCCCCAGCGCCAACGCCGCCGATCGCCATCTGTCGCGCTC
page-top