Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33654  (registered. 2012)
Contig Information
Length 741 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|30961800|gb|AAP38208.1|| putative cyclic nucleotide and calmodulin-regulated ion channel
Score 281
Evalue 5.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33654
TCATAGTGAGAGGCAAGCTAGAAAGCATCAGTGCAGATGGAAGCAGGGCTCCGTTACAAGATGGAGATGTATGTGGAGAGGAACTCCTCACATGGTACTT
GGAACACTCTTCAACGAATAAAGATGGCGGGAGAAGTAGATTTCATGGTATGCGTTTGGTTGCTATACGTACTGTGCGATGCTTAACGAATGTTGAAGCT
TTTGTACTTCGAGCAAGTGATCTCGAACAAGTTACTGGACAATTTGCACGGTTCTTGCGCAATCCAAGAGTGCAGGGGGCTATCAGGTATGAATCACCCT
ACTGGAGGACCATCGCTGCAGCGCGCATCCAAGTCGCATGGAGGTATCGTAAGAGACGACTAAAGCGAGCTGAAAGATCAAGGCCAAGCGAAGAACCCGA
TCGTATACTGGGTACATGTTCTCAGTATGCTTTTCAGCCTGGACAGAGGGGGTGATAGTCTGCCTAAGTATTTGTCTTTTTAGAGATTTCAACAAGTGAT
TACATACGGAGCAAAATGAGTGAATCTACACTCTAAAATATGTCTATATACATCCGTATGTGGTATCTATTTGAAATCTCTAAAAAGACAAATATTTAGG
AACGGAGGAAGTATTGGTTAACAGTTCTACATCTCCAACCTCTAGAAATCCTGAAATCCGCGGGACACAACTCTTTGGTTCTCTGATCTTGTACTTACAA
ATGTGTGAAACTAATCTCCTTGTATAGATATAAAAAAAAAA
page-top