Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig336  (registered. 2012)
Contig Information
Length 1084 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115441607|ref|NP_001045083.1|| Os01g0896800 [Oryza sativa (japonica cultivar-group)]
Score 545
Evalue 4.00E-153
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig336
TTCGGCACGAGGCCCGCTCGCCCGCCCGCGCCGCCGCCGCCGCCTCCTTCCGCAGGAGCTCCCTCCCCGCAGGCGCGATGGTGTACATCAAGAACCAGAA
GACAAGGGCGTACTCCAAGCGTTTCCAAGTCAAGTTCAAGAGAAGGCGCCAGGGGAAGACCGACTACAGGGCCAGGCTGAGGCTCACAAACCAGGACAAG
AACAAATACAATACCCCCAAGTACCGTTTTGTTGTGCGATTTACCAACAAGGATGTCACTGCACAAATTGTGTATGCTACCATTGCTGGTGATATCGTGA
TGGCCGCTGCCTACTCCCATGAGTTGCCTCGCTATGGTCTTGAAGTTGGCCTGACCAACTATGCTGCAGCCTACTGCACTGGTCTCCTTTTGGCTCGTCG
TGTGCTCAAGAACCGTGATCTCGATGAGGAGTATGAAGGCAATGTTGAGGCCACGGGTGAGGACTTCTCTGTTGAGCCTTCTGATGAGAGGAGGCCTTTC
CGTGCGCTCTTGGATGTTGGTCTTATTAGGACCACCACTGGAAACCGTGTGTTTGGTGCCCTTAAGGGAGCTTTGGATGGCGGCCTTGACATTCCACACA
GTGACAAGAGATTTGCTGGTTTCAAGAAGGATGAAAAGTCGCTGGATGCTGAGATTCACCGCAAGTACATCTTTGGAGGGCATGTCGCTGACTACATGAG
GTCACTAGCAGATGAGGAACCAGAGAAGTTCCAAACTCACTTCAGTGAGTACATCAAGAGGGGAATCTCAGCTGATGACATGGAAGCAGTTTACAAGAAG
GTTCATGCTGCCATCCGTGCTGATCCCACCATGGCCAAATCAACCAAGGCGCCTCCCAAGACTCACAAGAGGTACAACCCCAAGAAGCTGACCTATGAGC
AGAGGAAGGCCAGCCTCGTCGAAAGGCTCAACGCCCTCAACAACTCTGCCGGTGCCGCCGATGACGACGAGGACGACGACGAGTGAAATGCGTTTTTGTT
AAAGTCTGGCACCCTGCACAACGGACCTGTTCCTTTGAGTTTTGGTTATTATCTTGCTGGAGTTATAGATTGTGTTATCGGGAT
page-top