Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3358  (registered. 2012)
Contig Information
Length 869 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242064956|ref|XP_002453767.1|| hypothetical protein SORBIDRAFT_04g015010 [Sorghum bicolor]
Score 345
Evalue 5.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3358
CCACTAGAGAGAAAAATGAACCGTCAGCCAAATAAATAAAACTCACATAGTTACAGTTTCTGGCGACTGTTATGTACATTCATTCAATTATGAGTAGCGG
GTTTTGGGAAGTCGCTCCTTACAGAATGAATATTATGCAGCTTAACGTATTGATAGCCTGTGGTTTTGATGCAACTAGTGTGTAACAAACCAAACGATCA
CAAAGAAAATACCAAAATAAAGGAGAATTCCCGATGGAGCCCTGAAGTACATGTGCATAATGCTTTTTATATGTGAAGATCGTCCAGTGTTAGCTCTTCG
GCGGACATCATCTTCAGTTTTGTGATGAACTGGGGTGGATCATCAAGGCTGGACGAACCAAGGATGACCTCACGCTTCAGCTTCGATGAAAGCTTGTGTG
CAGCACGTAACTCTGATCGAGTAGCACCACCAATGACAAAAACAAATATACGCTGGCCATGCTTTTGGAAATCACTCGATGCATGCTTCAATACAGAATC
ACTTGAATAACCATCATCAGAACCACGAGGCCTAGCCCATGATCCACCAGTCCTCCTAGATCTCATCGAGTGAGCTGGGCTTGTGCGGGCTGAGGTACTG
GTAGTGGTAGGTCCTACATGGAAACTGGGACTAGGGTCGTTCATGCAGTTATATTCATCTTTTGGTAATTCACCCTTGCTGAGCTGCTCAATCAATTCCT
CCAGAACCGGATAAAATCGGGACAGTGCCCATGCTGATTGTTCCGTTGTTCGCTCTTTTCTATGTGCATGTTTTTTCTTCTGAACATCAAATTTCAGTGT
AAAACCTCCTCCTGNNNACTTTTTTGTGTCAGTGCATAAGCAGTGCATATTATTCACAGCGATCATGTC
page-top