Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33572  (registered. 2012)
Contig Information
Length 944 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|210061125|gb|ACJ05643.1|| ferritin 1A [Triticum aestivum]
Score 501
Evalue 5.00E-140
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33572
TAGCAAGCGCGCCGCCGCCGTTCGGGTTCGAGATGTTGCCTAGGGTTGCGCCGTCTCCGGCCACCGCCGCCGCCGCCGCCGCAGCGGTTGGCCAGCTCTC
CGGGGCGGGGCTCACCGCCGGTTCGGTGAGGCTGCCGGGGGCCCTGCCGTCTGCGGCAGGGTCGGCGGTCTGCTGCAGGGCCGCGGCGAAGGGGAAGGAG
GTGCTCAGCGGCGTGATGTTCCAGCCGTTCGAGGAGCTCAAGGGGGAGCTGTCCCTCGTGCCGCAGGGCAAGGACCAGTCGCTCGCCAGGCACAAGTTCG
TCGACGAGTGCGAGGCCGCCCTCAACGAGCAGATCAATGTGGAGTATAATGCCTCGTACGCGTATCACTCCCTCTTCGCCTACTTCGACCGCGACAACGT
TGCTCTCAAGGGATTTGCCAAGTTCTTCAAGGAATCAAGCGATGAGGAGAGGGGGCACGCCGAGAAGCTCATGGAGTACCAGAACAAACGTGGAGGCAGG
GTGAGGCTCCAGTCAATTGTCACACCCTTAACGGAGTTCGACCATCCTGAGAAAGGCGATGCCCTGTATGCAATGGAGTTGGCTCTAGCTCTTGAAAAGC
TGGTGAATGAGAAACTGCACAACCTGCACAGTGTAGCTACGAGGTGCAATGATCCTCAGCTGACCGACTTTGTTGAGAGCGAATTCCTTCAGGAGCAGGT
TGACGCCATCAAGAAGATCTCTGAGTATGTGTCGCAGCTGAGAAGAGTCGGCAAAGGCCACGGAGTGTGGCACTTCGATCAGATGCTGCTTGAGGAGGCA
GCTTGAAGGACACGATGACTACGGGCAATGGAGGATGTAGGTGTGATATGTCAAGTAGTGGACAGATAAGCCAACCACTGGATGTGGTTCTGAGGGATTT
TTGCAGTGGGGTTTGTAGGGTGCTATGCTGCTGAACTGCTCTGT
page-top