Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33569  (registered. 2012)
Contig Information
Length 1963 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|227133339|gb|ACP19711.1|| PDR-type ABC transporter [Triticum aestivum]
Score 1078
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33569
CGGCACGTACGCACACATTTAGTTTAGTTTTTGGGATAGTTACACAAAGGTGTCAAATAACCTTGTGTGTTTTGTAGGACATCAATAACAATAATAATGG
TAAAAATAGGGCCGGCATATCGCTACAAACTCTCAATCCTCTAAATAGCCGAGCTTATGCAACAATGTCTGCTACTATACACAAATACACACAAACTATG
GATTGCCGCTTCTCTCTTGCAGCAGCATAAACGGCCGTCTGCCTAACGTTTCTGGAAGTTCAACACCTTGATGGAGTAGCCGAACACCAAGAAGAAGCCG
ATGACGTAAGCGAAATGCGCGAGCACGACATACCCAAGGAAATCGTGCTTGATGCCCAGACTGTCCTCCAAGAATTGCTTCACCACCGTGGGGCTCCCAC
CGGCGACCACCGAAAGAGGAGTGGTGTTATCGCCAAACTGTGACCCGATGACGCCATAGATGGTCCAGGACACAGGGTTCGCCCAGTAGTACCACCTCCA
CCAAATTGGTATTAACGGTCTCGCAACGAGGAACCCAGCAAAAAGGTTCCAAAGAGGGAGTATAAAGGCTATGGGTATGTTTGCGAGCATGGAAGATGAG
GTCAACGCCACCAGCATCATGCCAAATAATGTGAAGTAGTTGAAGCATGAAATTATAAAGAAAAGGAAATAGAAGAACTTTGCAACTTTCCACTCATATC
CAATCATCGCATAGATGGTGACTGTGTACTGAATCCCCTGCACGATGTTGTAGATCATCTCCACGCATGTCTGAGCTAATGCATAGGATAATGGAGAGTA
CATCCCTGCCGCCTTTTCACGGTAGAAAACAGTTCGCTCGATTGACACAACAGGCTGAATTGTGATGCAGTTGGCAGACCCAAGGAAGAAGACAGCAGCA
TAAGTGGCTCCAAGTAGATTGTACAAATCTTGTGGTGAGTCTATTTTTGTCCCCTTCTGCCAAAACACTGTGCCAAATACAAGGCCATAGATCATAGTCA
TAAGAAAGCGCATGGCGTTGTGAGGTGGATTCTTCCAGTAAGATTTGTATTGCTTCCAGAAGTTTGCAACACATTGATTGTAGAAATTCTGAGAATACTT
TGTAGGAAATGAGAGATCTTCATAGCCAGGTGGGGGAATGCTTAATTCCTTAATAAGTTCTTGGTTTTTCCTATAAAGATCAGAATTAGCATAAATTTCA
GCAAAATTTACGTTCAGGCGAGCCTCAGCTAAAGGGGAGCTAACTTCCAGCATCCATGTTGCAGGATTATATCCTTCTGTGATCTTTTCAACACCTGGAA
TTGCCTCAAAATATTCAACTAATTTATGAGAGTGCTGACCAAGTTCACCAGCATAAATAACTCGTCCTCCTCTTTTCATAAGCAGAAGCTCATCAAAAGA
CTCGAATATATCGATGCTGGGTTGATGGATAGTGCAAACCACAGTTCGCCCAGTGTTCACTGTATTTCTCACTGCCCGCATTACAATTGCCGCAGCTCTA
GCATCAAGACCAGAAGTTGGCTCATCCATGAATATGATTGAAGGATTTGCTACCAGCTCCACGGCAATTGTCAGTCTCTTTCTTTGTTCAGTCGATAACC
CGTCCACTCCAGGGAGACCAACCATAGCATTACGCAACACATCAAGCTCCACAAGAGTCATGACTTCCTCCACAAACATCTTTCTCGTATTTTCGTCGAC
ATCTGAGGAAAGACGTAGCCAGGCAGAGTACAAAATGGATTCATACACAGTAACATTTGGTGAATGGATATCAGTCTGTTCACAATAGCCACTCACGCGG
GCAAAAGTTTCTTGATTTTTAGGGTAACCAGAGAGGGTGATACTTCCTTCAACAGATCCACTAGTTTTCCTTCCTGCCAGGACATCCATTAGAGTGGTTT
TCCCAGCTCCACTCACACCANCTAATGCTGTCAGAACACCAGGTCTAAAAGCACCACTGATAT
page-top