Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33550  (registered. 2012)
Contig Information
Length 1022 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig33550
TTTTTTTTTTCTTTGGGAGACGTCAACCTAGTTCTTCAATTAACTGGTCCTGACCACGAGCATGTCAAGAGACCTTCAGAACGAACATGAATGAAACGAC
ACGAACATGAATGAAACGACACGAACAGGCGATTCACCTACGAATTTAACTGATTATACAGAGATACAGAAGTAATAGAATCTCTTTTCTTTTCCTCGCT
AAAGATTTATACAAAGATGAAGCGACACGAACATGAACTCTCCTATCCGCCGTCCGTCGACCGACCGGTCGATCAGTGCACGAGGTAGGTGACGGCAAGC
GCGGCGGCCATGAGCAGGTACGCCACGGCCTGGTCGACCCTCCTGCCGTCGCCGGCCACGGCCGCCAACCCCTCCGCCTTCCTCGCCCCGCCCTGCGCCG
CGCCGGCAGCGGGCACGTCGACGTTCGCCGCGCGAGCCATCGCGTGATGACCGATGAACGACCCGCTCACAAGAATCGGCTCGACCGACGGTATGCCGGG
TCCTTCCCTGGTGAGCCGACGAAGAAGAAAGAAGATCTGGATCCGGGCTGTGGGTGTTGGTTATTTCTCCCTTGTATGAAGTATAGGTCCCTGTATATTG
TTGAAAGTATGAAGGAAAAAGAAGCCGTGGGCCTCGCATCATTTTGCTGATGAAGGAAGGGCGTTAGCTTCACAATTCGTTAGGGAAGTCGATGCTTACT
AGCTTTAGTACATCTAGTGGAAATTTCCGCTACTTGTCATCTTTTTATCCATGATGATGAAGAAAGAGTGTTGGCAGTTTAGAGGGGTGAATAATAACGA
GAGCCTTGTCCTCTGGGTTCTTTTGTTCCTTTAGGAATGGGATGCAAATTGGCTAGCGGTGTCCAAGTCGAACTGACCTCTCCCCCTTTGTTGTTACTTG
TTAGTCAGCAGTTGATTACTTGTGTTATGTAGTGCTGAGAGCAATTCATGGAATGAACAAAAACGCCGGGTGAAGCGCTTGTAAAATGTTGTAACCTTAT
ATAAATCCCTGCGATGTGAAAG
page-top