Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33529  (registered. 2012)
Contig Information
Length 1049 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_SP 1
WH_XA Root 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222630835|gb|EEE62967.1|| hypothetical protein OsJ_17774 [Oryza sativa Japonica Group]
Score 495
Evalue 3.00E-138
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33529
TTTTTTTTTTATTCACCTTCAATAATTTTTTTCTAGAGATGCATCGATTGTTCTACAAAGTTATTTCATGCGTCATTACACGTAGAAAGCACACCCTAGT
TTTTCAAGGAGATGTACCCATTCTTGATCATCCACTCCATACTCCAGTGGTTGTTTACATTCTTGAGAGTCCAATAAGCCCATCCAAATGTCGCCTTCCC
ATACACATCCATCTGTGCATTTGCAAACATTTGGAGCTCTTCCTTCGTTGCATTGGGCACCTGCCACTCAGCCACCCATTCGCCTACAAAGGTGAGAGGA
CCGTCCTGCTTCGTGACAGTGTTGAGAGCGCTTGAGTAGTTGGTTTTGATGAAATTGATATTCTGCTGCACGGTGAAAGTATCAAACATGCTGTTGAACA
ACACGTAGTAGTGCACGTCGATGACGGCCCTGGGTAACCCGCCGGCGAACTCGAGGAGCTCCGTCGGGTCTGGGGACGACAGCCGGTTGGACATGATCAC
GTAGGCCTCTGACGAGTGCTTCCTGACAGCATTGTACCCGTCTTGATAGTACGTTTTGAGGCTCTCCAGGGACGCGCCAGGCGCCAGCGGCTCGTTCAAT
AGCTCCACTGCGAGGAGGCTTGGGCTCGCAGCGTACCTGGATGCAAGGAAATCTATCACTTGTACGGTTTGCGCGATGTTAGCGGCGCTAGTGCCCCAGT
CTTGCGAGCCATCCTTGGAGGCGCTATGCTCGAAGGGGTTTTGTGACCCAGGAGCTGCGTGTAGGTCGATGATGACGCCCAGATTGTACTCCTCTGCCCA
TTTGAATGCCTTGTCCAAGGTTTGAAGCGAACCTCCGACGTAAGGTGCTGGAGGACTGGGGTCGCTAGCGATCCACCATCCCACTGGTATCCTCACTGCG
GTCAGCCCGCTTTCGGATATGAACCTGAAGTCATCCTCCACTATATATGTGCTCCAGTGGTTCTGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGC
CCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTC
page-top