Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3348  (registered. 2012)
Contig Information
Length 914 bp
Clones alternative view 62 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23℃ 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 9
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115455697|ref|NP_001051449.1|| Os03g0780400 [Oryza sativa (japonica cultivar-group)]
Score 277
Evalue 1.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3348
TTTTTTTTTTGGAGAGACAAGGGATGGTAATAAGTCAGGCCAAGCCAAGGAACATGACACGATGGATAGCATTCAGGAGAATCCAAGCCTAGCAAACCAG
TATTAATACCACAACACATGCGTTTTTCAAGGGGTGTTTCTTGCGTTTACAGGCTCCGACATCATACGAGTAGAGACCTCGGACAACACTTCATCAGCTA
GAGCCATGCATAACAGCTGAATGATACTCTTACGTTTTACAGGAAACCTGGATATATCTGTCTTATTAACAGCACTGCGGCAACAGCATTACCACGGACA
GCATGGATTTGCATCCGGCTGAAGCCCACAGGTGATCATGGATCCGCCCTAGTGCGCCCGGTCGCGGAGGACATCGAGCTCCACCTCGGTCGGGTCAGTT
GCCTGGATCTCGTAGTGGAACCCGTCGAGCTCCTGCTTGATGCGGTCCTTGGAGGTGGAGTACAGCATCTTGGCGCGGATGCGGGATGTGTCAGGGGACC
AGGCAATGAAGAAAATCTTGCTTTTCTGCACATTCTCCCCAGTAACAAAGTCAAAATCATAAAGGGCATATCTGCAGTCATTCTCTGGGAGACAAGCCAG
GAAATCATCATAACTCTCAGTTGTAGCCCCCGTCTTCTCCACAACAACCTGCTTTTGCTTTTCTTCTATTTTGAAGATGACATAGCGAAATGCCTTCTTC
ATCTGAAGCTCCAGGAATGTCTCCCTGATATCAGGAGCAACTCCCATGCCAGAGGATGCATTGGAGGAGGTGCGCATGAACGCCATGGGGTCGGGTCGGG
TCGGAGGGGGGGACGGGCGGCGCCTCCGCGTCGATCGCACGCGGACGGGTTGAGGAGGAAAGGAGACGAGATTATTCCCGTTGCTGTTCTCTTCCCTTTT
TTCAGAGGGAGCGC
page-top