Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33458  (registered. 2012)
Contig Information
Length 948 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 3
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 446
Evalue 2.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33458
GACAAACTGAATTCAGGCTCACTTATTCATTGTTCACCAAAGCTGCTGCACACCAGCAGAAGTTCGAAGATACAAATGGTAACACTGCATCAATGTACGG
TACAGAAACAAAGACAGGATCAGGCAACCGCAGACACAAACGAGACTCAATGAAGGACACCAAAGACCAGACTTGCGGACCCAGAGACCAAAGCAGAGCT
CCATGGCCAGGAGCTTTACTGGCCACCACGGAGACGGAGCACCAAGTGAAGGGTGGACTCCTTCTGGATGTTGTAGTCCGCCAGGGTGCGGCCATCCTCA
AGCTGCTTACCAGCAAAGATCAGGCGCTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGGATCTTCGCCTTCACGTTGTCAATGGTGTCAGATGACTCCA
CCTCCAGGGTGATGGTCTTGCCCGTGAGGGTCTTCACAAATATCTGCATGCCACCACGGAGCCTGAGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTT
GTAATCCGCAAGGGTGCGGCCATCCTCGAGCTGCTTGCCGGCAAAGATCAGGCGCTGCTGGTCCGGGGGGATGCCCTCCTTGTCCTGGATCTTGGCCTTC
ACATTGTCAATGGTGTCCGAGGACTCAACCTCCAGGGTGATGGTCTTGCCGGTCAGGGTCTTGACGAAAATCTGCATACCACCACGGAGCCTAAGCACCA
AGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCTGCAAGGGTGCGGCCATCCTCGAGCTGCTTGCCAGCAAAGATGAGACGCTGCTGGTCCGGGGGAAT
GCCCTCCTTGTCCTGGATCTTTGCCTTGACATTGTCGATGGTGTCAGAGGACTCGACCTCAAGTGTGATGGTCTTGCCGGTAAGGGTCTTCACGAAGATC
TGCATCTTGAGGAGGAGGAGGAGAGAGCCTTGGCTTCGCTTCGATGGG
page-top