Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33397  (registered. 2012)
Contig Information
Length 882 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20043018|gb|AAM08826.1|AC113335_6|AC113335_6 Putative protein phosphatase 2C [Oryza sativa Japonica Group]
Score 375
Evalue 4.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33397
CACCAACACCAAACTTAAATTTATATCACTTAGATAGGCGAATTGTGGTTCTTGAACTAGACTACTTTACACAGGCGAACTTTGCACGTGTCGCAGTTTC
TGAACTACTGATGCAACGCTTTCATAGACAGTGCGTGCAGCTGCCTGCAACCAAAATAGCTTGTCACCTCGGGGGCCTTCTATAGCTCAAGCTTCGGATC
TCCGGACAATCGACACAACGATGGCTGTGTCGTCCAGTTTCCCCCCGCTGAAACCTAGGTAACCCGCCGCGACGGCAGAGTCTGAAAATGGGCTTCTCCC
TGCTCCAGACCTCCCCACCTCATGTGCCCTGGCAGCAAGGTGCTCGGCCATCTCCGCTGGCTTTAGATCTGCCTGCAAAGATTTCGAGATCATGGCTGCC
ATTTCTTGTTCGTAGACGTTGTCGAAGAGGCCATCGGTCGCTGCTATAATGATATCGCCTTCCTCTATGTCAATGGTATAATTCTCTACAAGGGTTAAGG
GATCAACCCCTTTCTCGATTTGATGTGGAAAATTGAAGCCATAAACCATTGGTTTTGATTTTGCGCATACTTCTCCATTCCTTATCACCAGAAACCCCGA
GTCTCCAATATTTGATACATGAAGAAGCTGGCCATCAAAGTGAGCAACTAAGACAGTCGAAGAACCAGGAGAGCTTGCTTCTGCTGCAGCCTTGGAGAGA
ACTTGCTCAGGCGCAAGCTCAGAGCCTCCTTCACTTTCCGCAATTACCTTTTTACAGCCATCCATAAGCTCTCTTGCATAAAGCCCTGCGTTGATTCCTT
CAAATGACCACTGACCAACTCCATCTGCCACACCAAACCAACCATTGTCTTCAATAAAATAAGCATCTTCTCCGCCTGTCGC
page-top