Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33337  (registered. 2012)
Contig Information
Length 943 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226493776|ref|NP_001151655.1|| FK506 binding protein [Zea mays]
Score 393
Evalue 1.00E-107
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33337
ATCCCCTTCCTTCCTTCCTTCCTTGTGCTTCTTCATTCAGCTGGCACTGCGAGTGAGCGCGGGATTGGAGGAGAAGGAGATGGAGCTGGTGTCCTCCTCC
CGCTCCACCCTATCCTCTTGCAGCCGACTGGTTGCTCCCTCCAGGTCCAGTTCCACGACGGCATCCGCAGCCGCTAGGCGCCACGGGAAGAGGCTATTAT
GTGTCTTGGGTGGAGACAGGAATGGTAAGCTCAAGATCGGGAAGCGGGCGGCTCTTGCTCTGCTCCTGGCTACGCCCACGCTCTCACTGCCCTTCTCCGC
CCACGCCAAGACCAAGACCATAAATCCTTATGACGAAAGACGCTTGCTTCAGCAGAACAAGAAGATCCAGGAAGCCAACCGTGCACCTGATGATTTCCCA
AACTTCATCAGAGAAGGTTTTCAGGTCAAAGTAGTGACACCCGACAACTACATAACTCGGGACTCCGGATTAATATATGAGGACGTCAAAGTTGGTACAG
GCGATTGCCCAAAGGATGGTCAGCAGGTTATATTTCACTATGTGGGCTACAACGAATCAGGACGAAGGATAGATAGCACCTACATCCAGGGTTCGCCTGC
CAAAATTCGACTAGGCAACAAATCATTAGTTCCAGGTTTTGAAGAGGGGATTCGGGACATGAAGCCAGGGGGGAAGAGAAGACTAATTATACCTCCTGAG
CTTGGTCCTCCTGTTGGGCCATCGACGTTCTTTAGCGCGAAACAGTTTGAAGTATTCGACGTCGAGCTACTCTCAGTGCAGGACTGCCAGCGGAGGACAA
TAGCTTTCTACTCTGATGTTGTCTGCACTTGATCATCTGGTCTGTTAGTCCCGACCGGTGCAGCATTCTCCTCCTACAACCCTGTAGGAAAAAATTGTTA
CCTATTNNNNNNGAGAAAACGCAGGGGACCCATGCGTCTCATT
page-top