Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33319  (registered. 2012)
Contig Information
Length 1181 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461843|ref|NP_001054521.1|| Os05g0125500 [Oryza sativa (japonica cultivar-group)]
Score 649
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33319
CCAGATCACAGGTAAAAGATTGAACTTTATTTGCAAGAATGTTGGACATGTACAGAAGTATGAGAAGGATTGGATAGAACATCATCAAACATTGAACATC
AGGGACAGTTCACTAATGGTCTAATCCTGCTCACCTCCTCCAGTTAGAATATGCACTGATAGCTGGCTTCCAGAAGAATAATCTCAGTCCTCTTTGAACA
GTTCACGACCAATTATCATTCTTCTGATCTCACTAGTGCCAGCTCCAATCTCAAACAGTTTTGCATCTCTCAGGAGACGGCCAGTTGGGTACTCATTTAT
GTATCCATTGCCACCAAGACACTGGATTGCCTCAAGTGCAACTTGTGTTGCCCTTTCAGCAGCAAAGAGGATCACTCCTGCACAATCCTTACGGTCAACT
TTGCCATTATCACAGTCCCTGGCAACTGAGTATACAAATGATCTTGATGATTGCAAGGAGGTGTACATATCTGCCATTTTCCCCTGTAAGAACTGAAATT
CACCAATCGGACGGCCAAATTGCTCCCTTTGTCGAACATAAGGAAGAACAACATCAAGGCATGCCTGCATGAGCCCAATAGGGCCCCCAGCTAATACAAG
TCTTTCCAGATCAAGACCAGACATCATGACATAAACACCTTTCCCTTCTTCACCAAGAACATTCTCTTGAGGCACAAAGCAGTTCTCAAAGACAAGCTCA
CATGTGTCACTTCCTCGCATGCCAAGTTTGTCCAACTTCTGGGCAGTACTGAACCCGGGCATTCCCTTCTCAATTATGAATGCAGTTATTCCTTTCGATC
CAGCAGTTATATCTGTTTTCGCGTAAACAACCAATGTCTGAGCAGACGGACCATTTGTGCACCACATCTTGTTCCCGTTAATGACATAGCCGCCATCTAC
TTTCTCAGCTTTGCACTTCATACTGACAACATCAGAGCCAGAGTTTGGTTCACTCATCGCCAATGCCCCAATATGCTCCCCACTGATAAGCTTCGGCAAA
TACTTTTCCTTTTGGGCAGGGCTGCCATGACGGACCAGCTGGTTGATGCAGAGATTTGAGTGTGCACCGTAGGAAAGGCCGACCGACCCGGACGCCCTGC
TGATCTCCTCCATGGCGATGCAGTGGTACATGTAACCGAGCCCGAGCCCTCCGTACTCCTCTGGCGAGGTGAGGCCGTGCA
page-top