Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33318  (registered. 2012)
Contig Information
Length 736 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31296712|gb|AAP46641.1|| HGA1 [Hordeum vulgare]
Score 364
Evalue 4.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33318
TTTTTTTTTTGAAACAGCTTTAACTTTCTCTTTACTCATGGTAAATAAATCAACCAATATACCAACGCTTCTTCTATGTATGTATGCTCCACCAAATTCA
GAGGCCGTAAAATGCCCCTAATTCATGTACCAACCAAAAAGAAAAAATTCTCTGTGGCCGATGCAGTTCCTACTTCTGCCGGAGATGTTCGATGGCCAGC
GCGAGCGTGGGCGCGAAGCGCTCCACGTCGACGCGCACGTCCTGCTTGCCGAGGTAGTACTCGGCGACCTTGTCCCAGCCGCTCCGGTGCACCGACTCGG
GGTCCTTGATCACGGGGTGGTCCGGCCCCAGCATCTCCAGCAGCGTGCTCTCCTCCGCCGTGATGCTGTACTCGAGGTACCGGAGCCCCATGTCCGCCAC
GGGGTCGCCGAAGTCCACCTTCGCCATGTGCTCTAGGTTCCCGTACGGCACCACCTGGATGACCACCGCCCCCGTGGGCATGAACACGGCGTTGGTCAGG
CCGGCGCCGTGCACGCCCAGCAGCACGTCGAACGAGTTCACCGACCGGGCCAGCTCCTCCACCTTAACGTCGAACCGCGGGTCGGCTATGGACACCTCAA
ACCCGGCCTTCTCCGCCGCCTTCACGATCTCAGGCACGTTCACGAACTTCCGGTAGTGGCCCCGGTGGAGCAGCATCAACCGCGGTTTCCTCTTCTCCTG
GTCCTCCGGCGGGCTGATGTCCTTCATCAAGCTGAT
page-top