Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33314  (registered. 2012)
Contig Information
Length 864 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115442287|ref|NP_001045423.1|| Os01g0952900 [Oryza sativa (japonica cultivar-group)]
Score 243
Evalue 2.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33314
TCGAACGCTGTGTTCCCTACCTAATTAATCTCGATTAATCTCTAATCCGAAAACGATCTACGCTCATTAGCTAATTACATTATTGCGAAGAGAGCAGCAG
CCTGGCCGGCGACGGGAAGATCCTCCTCTTGCTGCGCTCGGAGATGGTCTCCAGCCCCGGCGACCACGGCCGGCCCTTGGCGCCCACGAGCTGCGCGTAG
TGCCGCTTCAGCTCCGGCGTGCTGCACAGCTCCGTCGCGGACGCAGCCACCTTGCCCGACCCGCGCCGGCCGGCAGCGTCGCCGTTGCCGTTGCCGCCGT
CGCAGGTGATGACCTTCTCGATGAACTGCGGCAGGACCCGGATGAGCGCCGCGGCACCGTCCTCGCCGCCCTTGACGTACTCGAACGGGCACTGGCCGGG
CCCGGCGAGCTGCACCGTCTTCCTGCCCCCCGGCGCGGCCGACAGCGACGCGAGCGTGGCCGCGGTGAGCACGGCCGCCTTGCCGTTGCCGCCGGGGGAG
GGGGAGGAGAGGAGGCGGCGGGGGAGCACGAAGTAGGTCCGGCCCGGCAGCAGCCGCTCCCCCGGCGACGCGACGGGGACCGGGAGGCCGACGAAGAAGG
AGTCGGCCGGGCAGACCACGTGGTCCGCCGGGAGCAGCTCGGCCGTCACGTCCGCCGCCGTGCAGGAGACACCGCCGTTGCCCTCGCCATCACCCTCCTC
GTCCTCGTAGACTGGCAGCGCCCTCGTCCGCCCGCCCCAGTACACCAGCCGGGCCGCGGCGGGCACCTCGGCGGCCGCCGGCATGTTCACGCAGGGAGAC
AGCCCGTTGCCCATGGCGAGAGGAGAGAAGTGTATGGCGCCTGCCTTCGAGAAGCTTCTAGACG
page-top