Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33313  (registered. 2012)
Contig Information
Length 715 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242074752|ref|XP_002447312.1|| hypothetical protein SORBIDRAFT_06g032690 [Sorghum bicolor]
Score 273
Evalue 1.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33313
TTCATCGGGCAGGCGTACAGCGGCGTGCCGTGGTTCNAGGCCGGAGCGCAGCCTGGCGCGGTGGCGCCCTTCTCCTTCGGGTCNNTCCTGGGCACCCAGC
TGCTGCTCATGGGGTGGGTGGAGTCCAAGCGGTGGGTCGACTTCTTCAACCCGGACTCCCAGTCGGTGGAGTGGGCCACGCCGTGGTCGCGCACAGCCGA
GAACTTCGCCAACTTCACCGGCGAGCAAGGGTACCCGGGCGGCAAGTNCTTCGACCCGCTCGGCCTCGGTGGCGAGACCAAGGACGGCGTCTACATCCCC
GACACCGAGAAGCTCGAGCGGCTCAAGGTGGCCGAGATCAAGCACTCGCGCCTCGCCATGCTTGCCATGCTCATCTTCTACTTCGAGGCCGGGCAGGGCA
AGACGCCGCTCGGCGCGCTCGGCCTATAAGACGATTTTTTTGGCTTGCGCGCGTGGTGGGAGAGGGGTTGTTGCATTGCATCAGATCGGACGCATGGATT
GATGGGATCTGCTGGAGGTCGAAGAAGCAGCAGCANNNTATCTGTGTCCGTGACTTCTTTCGGGTGGTGTGTGTGAATCGAATGGGGAATCAAGTACTCT
TTCTTTCTCCAGCGTATGTACCATGTAATATATATAGTCTGAGCTCTGTAATTTAAGGCAGAATGAGCAAGGGCATTTGATTCATCACCTACCAAGTCTT
TTACTAAAAAAAAAA
page-top