Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33308  (registered. 2012)
Contig Information
Length 809 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XE Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470199|ref|NP_001058698.1|| Os07g0105600 [Oryza sativa (japonica cultivar-group)]
Score 269
Evalue 2.00E-70
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33308
TCAGCTTCCAGGCTGCCCCCACCGCCACCGGCGGCGGCGCCGGCGCGTCACCGAGGCCGAGGCCAAGAGCGGTGACACGCCACGCCTCCGAGCCGTCGGG
CAGGCGATCAGTTTGCCTCCGCCTCGGCATCAGCCTCGCCACCGCCGCCGTGCTCCACACAGCGCCCGCCCACGCCACCGACGAGGACCCGGAGCCGGAG
CCGGCCAACAACGGCTGGTGGCTCACCGAGTTCCCCTTGCCGGTGCCCAAGATCCGCAACAAGGAGATCAATAATGGCGAGTCGGGGACGCGGTCCTTCG
TGAAGAACGGCATCTACATGGCCGACATCGGGCCGAGCTTCGCGGCGCACGCCTACCAGATACGCAGCTCCGCCTTCGACCTGCTGGCGCTGGAGGACCT
GCTCGGCAAGGAGGCCTCCAACTACGTCAACAAGTACCTCCGCCTCAAGGCCACCTTCATCTACTACGACTTCGACAAGCTCATCACCGCCGCCGACCCC
GACGCCAGGCCGCCGCTCCTCGGCCTGGCCAACCGCCTCTTCGACAGCTTCGAGAGGCTGCAGGCCGCCGTCACCACCAAGGACGACGCCGACATCGGGT
CCTGCTATGCTGATACCAAGCTCATCCTGCAGGAAGTCATGACAAGAATGGCCTAGCTAGCTAGCTTGCTTGCTAGGACAAACACCTCTTTAATTTTCTC
TGAATGTACATTTAGTAATGATACTGAGAAATACCACGATTTTAGTCTTGAACAATTTGGTAGAGATACCACGCAGTTAATGGAATGCTTCTTCCGAGCA
AAAAAAAAA
page-top