Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33304  (registered. 2012)
Contig Information
Length 736 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222635911|gb|EEE66043.1|| hypothetical protein OsJ_22026 [Oryza sativa Japonica Group]
Score 288
Evalue 4.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33304
CCGGGCAACGTGATCCGGGTGTCGGAGGTGGGGAAGCTGATCGACATCGCGCACGTGCAGACGTACGTGATCAACAGCGCCAAGATCGTGTTCCTCAACG
GCCGGCCGCAGGCCAGGCCCGGCAAGGGCGTCACCAACACCTGTGAGATTTGCTGCCGCAGCCTCCCGGACTCGTTCCGCTTCTGCTCCCTCGGATGCAA
GCTCGGGGGGATGCAGTGGGACCCGACCCTGACATTTGCCATCCGGCCCAAGCGTAGCCAGGACTCCGGCGGAGAAGGGTACGGCTCCGAGGACGACTCG
TTCAGCCCGAGGAAGCAGCTCCGGAGGGCCGGGTTCGAGCTGGGACGGTTCGACCGGAGCGTCCGGTGGTCTGACGACGAGGGCAGCAAGTCCAACACCC
GGCCGATGACACCAACCACGCCGCCGATCAGCCGGTGCCGGCCGTCCAGGAGGAAGGGCATCCCCCACCGTGCCCCGTTCTACGGTTAGACTACCGGTGG
AAACCACTCTCAAAAGTGACAATGCTACTACTAGTATTGCAATGCAATGTGTGTCGGTTGGGACTTGGGCCTGAGTAGTGAAGTGATCCAGTTAGTAGAT
CACTAGCTAGGTATTAGCTATAGCATGCATGGTATATATACTTGTATATATATACATATACATACACACAATAATGTAGGTGGAGTGTGTGTAAATATGA
TATGTTGGCAAAGGTTGCCAATTCGCAAAAAAAAAA
page-top