Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33300  (registered. 2012)
Contig Information
Length 798 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig33300
CAGTTGTTATTAGTACATTCAGAATTTTTGCAAGGTTAAGTAGCACTTAGCATAAACATAAAATTTACAGCGACACGATGCCTTTCAGATGTAAGCATCG
ACCAAAGTAGGAGGGATCAACAAGTTTGCCACAGACTCCTTGTTCGTGTTCTCTTTCTTCTCCTTCGAGCCCAGGGCCTCCTCCCGGACCATCTCCAGCT
TCTCCATTACTTTCCTCTTGTTCTCTTGTCTCGAGGTTCTGGCTTCAGCATGTTCAGCCAGCAGGAACATTGCAAAGAAGGCAGACGAAATGTATGCCAG
GGTACTTCTACGAGATGTCCTACTCGCTACTTGGACAATGGTTGACTGCAGAAACAAGTGCTAAACCGATACGTAACAGGGGAAGTTCAAGCCTCGACAG
AGGTTAGTAAAAATTAAATCACGCACGAAAAGTAACAACAACCTTGACATGATAACTCTGTCTACAAGAGGTAATGGCTTGAGTCCAAGTGTGATTAGAT
GACAGGATACACATCGTATCAATTCACGTAGAGATAAAGCAGGACTAGAATCAAAGTTTTCATGCTCCATACGAGTATAACTTCTAAAAAGTTTTTCTAA
AAACAGGATGACCCCGGCCTCTGCATCAGGACAATGCAAACATCACACTGCAACAAGTATATGCATGAAAACTTAAAGACTAAAGAGTTCGTTCACTACC
TTCAAATGAATACGCACCATATACTTAGTCAAAAAATCTACTCCCTCCGTACCAAAATATGTGTCTCAGTTTTGTACTAACTTTAGTATAAAGTTGTA
page-top