Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33299  (registered. 2012)
Contig Information
Length 578 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig33299
TCAAACAAAACACTGTCATGTATCATCCCATGAAAGAATTTTTGAATTGCAGAGCAAACTAATAATTCATTTATTATGCATAAAGAATTATACCCAATTA
CGTACACGACTGTAAGCACTGTCCTGTGTCATCCCTCGAAAGAAAATAATGAGAAGGGAAGAAGCGATGGAACTGTGGCATTCAGCTCGATTTTACAAGT
GCCGAGTGGCGAGCGGCGACCATAGTACGTACAGCTCTCCTACAGCAGAGCGCCATGGTGTCCGTCCATGCCGGCCGGCATGGACGCGGGGCTGAGCAGC
GGCGCGGAGAACCACGACGAGTAGTCGAACTGCTCCACGGGGGCGGCCTCCCCGCGCCCGTGCGCCGCGGCCGCGTGAGCCGGCGCCTGCGTCGTCGTCG
CCGTCGACGCCGTGCCGGCGCCGGTGAGCCTCTGCACGAGCTCCCGGAAGTCCCGGGGCTCCACCCGGTACACCCTGGGCGGCGGCGCCGCGCCCGCGCC
GCGCCACGGCTTGGCCGGCGCCCTCTGCACCGCCCTCAGCGCCGCCTCGTGCCTCCCCTCGCCGTGCTCCATCGACCG
page-top