Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33297  (registered. 2012)
Contig Information
Length 807 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 6
Wh_SHDr Shoot grown with dessication 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242056891|ref|XP_002457591.1|| hypothetical protein SORBIDRAFT_03g009910 [Sorghum bicolor]
Score 172
Evalue 3.00E-41
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33297
TCCATCTCCTGAACTCCACATCGTCCCGGTGCTAGCTCGACCAATTGCATCATCTATCGTTTGTTTTCCCTCAATCTCTAAGCCGATAGAGAGGTGAGAG
TTTGAGGGGTAGGTCGGCCGACCGGAGGGGCTGTGGACCATGTCTGGCGTGTGGGTGTTCAAGAACGGGGTGGTGCGCCTGGTGGAGAACCCGGGGAGCG
AGCGGACGTCGACGGTGCGGCGGAAGGCGCTGCTGCACACGCCGAGCGGGCAGGTGGTGTCGTCCTACGCGACGCTGGAGGCGAAGCTGACGGCGCTGGG
GTGGGAGCGCTACTACGAGGACCCGGCGCTGTATCAGTTCCACAAGCGCGGCTGCCTCGACCTCATCTCCCTCCCCAGGGACTTCAACCACTTCTCCTCC
GTCCACATGTACGACGTCGTCATCAAGAACAGGGAGTCCTTCCGCGTCGTCGACGCCTAGCCAGCCCTCTTCCGTCCATGCAGTCTCTCGATCTCGTCTC
GTCTGTTCAGCTATAGCTCTTCCATCGTTTGACTTGATTTGCCATGCAGGGTTTGTTGTTAGTGATCGGGATGTTATATACGATTGGTTGTGCCTAATTT
GGTTGGGAAGTGTAGTGTGGTAGTGGAGTGAGCGAGGGTACTGTTTTTGCACACATATGTGCGCGTGGTGCCTGAGTATATGCATAGGTTTTCGTTGTGG
TGTGTATATGTATGCGTGCTGTGGGGTGTGTAAGATCTCTGTTTTGATGTAAATTAGTGTCCGCGTGATGACTATATATCCACTTACGTTCATTTGCAAA
AAAAAAA
page-top