Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33296  (registered. 2012)
Contig Information
Length 859 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242050368|ref|XP_002462928.1|| hypothetical protein SORBIDRAFT_02g034690 [Sorghum bicolor]
Score 189
Evalue 4.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33296
TGGGTCAGTTTTTGTTTTTTTAGGCCACAACAAACTAGAAAGAATAATAGTACTCCAACCATCTTCGGTTGAGTCCTACCTAACTACACAATCAACAACA
ATTCAACAAAATGTACAATGATTCTACAACAACAAAGCACACCATCTTTTGGTCTTTCTCGCGAATTCTCTCGCTTCTCATGAACTCGCTGAAACAAAAA
TCAAACAAACCATATTACAAAATTTGCGACCCAAAGGAAGAAAAAAGGGGGATTTTTTTTCTGATTCCGAGCAGCCCGGCCGATCCGGTTCAGTTCATCC
GGGGAATCCGGTTCGGCTCCAGACGGCGTCACGCACCCGCGACGCGTCCCGGCCCTTGAGGGTGCGTCCGACGCCCTCGACCACCGAGGCCCTGGCCTGA
CGCCGCGCCAGGTACACGTGCGGCGGCACCCAGCCGTCGGCGTCCTCTTGCTGCTGCTCGTCGGGCTCGGGCTCGGGCTCCAGGTCGGCGAACCGGCTCG
GCCACGCGGGCACCTCGACGGGCGCCGACGACGCCACCTGCCGCCCGTCCGCGAACGCGTGGCTCAGGCCGCCCACGCGCCGCGGCGGCTCGCCCCTGGG
CGCCCTGTCGGTGCGCTGAACCCCGTCCTGATCCGCGGTGGTGGTTGGCGCGTCCGACGATGGCGAATACCAGACGTCCGACTCGGCCAGGTCCGGCAGG
TCGTCGTAGGGGGACGGGGCGACGGTGGCGGAGCCGGGGCGGTGGTGGAAGCCGAGGAAGCGCTCGGCGGCGGAGAACGCCGTGGGCTTGCGCGCCTTGG
CCATGGGCCGCAGTGTGCCGACGACTGGCTCCGGTCGATTGGTTTGGCTGAGCGCGCCC
page-top