Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33295  (registered. 2012)
Contig Information
Length 1339 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187234|gb|EEC69661.1|| hypothetical protein OsI_39081 [Oryza sativa Indica Group]
Score 555
Evalue 6.00E-156
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33295
GGGTTCTTTCGGCTGCGTTTACCTGGGAAAGCTGAAGAATGGTCAAAAGGTTGCCATCAAGGTGCTCTCCTCCGAGTCAAAGCAAGGAACAAGGGAGTTC
TTGAATGAACTGAGTGTCATATCCAGCATAACCCATCACAACCTTGTAAAACTGCACGGCTGCTGCGTCGATGGAGGTCAGAAAATGCTGGTGTACAATT
ATCTGGAGAACAACAGCCTCGCACGAACCCTCTTTGGCAATACCCACAGTAGTATCCGCTTTGACTGGAGCACAAGGGCGAAGATCTGCATTGGTGTCGC
CGACGGTCTCACATATCTGCATGAAGAAATCCGGCCACATATCGTCCACCGTGACATCAAGGCGAGTAATATTCTGCTTGACAAGGACCTGAGCCCCAAA
ATATCGGATTTCGGGCTAGCAAAGCTCTTCCCGGGCAACATGACGCATATCAGCACGAGGGTTGCAGGAACATTAGGGTATCTGGCACCGGAGTATGCAA
TCCGAGGGCAGCTGACAAAGAAGGCTGATGTGTACAGCTTTGGGGTTCTGCTGCTGGAGATTGTCAGTGGCAGGTGGCACACTGACCCCAGATTGCCTCT
CCAAGATCAGTTCCTCCTAGAAACGGCTTGGACACTCTACGAGTCTGGTGATCTTGGGAGCATCATCGACAGGACCTTAAAAGATGGTTTCAGCACCGAC
GAAGCTCATAAGTTTTTGAAAATAGGACTTCTGTGCACCCAGGATAGCCCCAAGGTCAGGCCCTCCATGTCGACAGTCGCAAAGATGCTAAAGGGTGAGT
GCGCCGTCAGCGACAAGATCATGAGGCCAGGCCTGATCACAGATGTCATGGACCTGAAAGTCAGAACAATCGAGCCTGCTCTTCAGTTAAGTGTGTCTCC
ACCAATGTCTCCACTGGATAACCACTCACTGGTGTCTAACCTTGCATTCGCTGGTAGCACTGTGATAAGGGACAGCCCCTAATGAGAGGTTAAAAAGGCA
CATGAAGGAGAATATGCTCAAGCAACAATGGCTGTAAATTGGAGGGATGACGAAAAGCATATCAAGAGAGGCATTTGATTTCGTTTGTGTTTCTATATTG
CCAGTTAGATATACTGTTAGTTGTTTGTATATGTTGCATCTGAGCTTTTGGTGATCAACAACTGAAGATCCTCAGTGTCCTGTGGGGCATGGCTTATAGG
TGAAGGAAGAAGGGCACAGCTGCACCAGGCACCCAAGCAGGGAGCCCTGAACTTTCAGAGGTTTGCTAGTTAGTACCTTTCCTAAGCTAAGCAAGCCAGG
GTTACCTTTTTTGTGTGCACAGAAATAGTAGCTACTGTA
page-top