Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33291  (registered. 2012)
Contig Information
Length 938 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SHDr Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242069719|ref|XP_002450136.1|| hypothetical protein SORBIDRAFT_05g001050 [Sorghum bicolor]
Score 358
Evalue 2.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33291
TTTTTTTTTTACAAAGCATATCAATATGTATTTCATTATGATATATGTTACATCAAAGAAACAGCTTAATCCATGTCCTCAACTTAGCAACAGTTATTAC
TTGTCAAATACAGAAGAAGGAACAATTTATTTGTGACAAAGAGCACACATGCAAAGTATATATATAACACAATTACTCGAGCTGAAAAGAAAAAAGTTGC
GGAACTAAACATAATAAGTGAGATATCTAAAGCTACCCTTGAGGCTCCTGCTGACCATCAGCTCCATGCCATGCCCAGACAAATGTCCTTCAGTGCTGGC
CGGATGCTCTCCTCCAATAGCTTCTGGTACTCCAGTGAATCACCGCTTGTTTGTTTCATCTCAATGAGATGGTACGAGGGGCTGATCTCAAAGATCTCCG
AGTCAAACTGAAGAACACCATTCCTGCCTTCCTTCCTCACTTGCATCTTGACAACACCATTATCCTTCTTCCTCACCCTGAGATTCAGCGTCTTCGCAAC
AGCTTCCAGCTTCGAGACAATGGCTGAGGCAGGCTGTTCTGAAGTGAACCTTGCTTCCTTTTTGCTCTCCTTCTCGACGAATAGGCCAGAGAGGTCAAAC
CCTGTGGAGAAAGAGATGATTTCAAAGGCATTTAAATTTGTCACCGCCAGGGGCTTCGCGTCTTCGTGACTGTTCTTCCTGCGCCTCACACCAAGTGTTG
GAACAGCATCCGTGTTGGCATTCTCACTTGGCAGTCTCTCCTTCACTGTAAGGTTCTCCCCGGGACCTTTCCGGAACCAGGTGGACTCCTTTATCTTCTG
GATTGATATCCTCTTGTTCGGATCAGGGTCCATGATCTTGTACAACAGCTTCTGAAGTTTTTGGGAAACCCAGCCAGGGCACCTGAAATCGCCTTTCTCA
ATCTTCCGGTACATCTCTATCAAGTTCTGACCTTGGAA
page-top