Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33290  (registered. 2012)
Contig Information
Length 998 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125543065|gb|EAY89204.1|| hypothetical protein OsI_10700 [Oryza sativa Indica Group]
Score 356
Evalue 2.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33290
GCTTGTATGTGCCTTTTGTACAGGAACAACCCGATTTACATAGTACACGATTTTATGTTATAACCTTACAACAACATGCGTCCCTCTGGACTGCAAAGGC
ACAGCAAGTCCGCATATGTTGTATTAGCAACAAGCAGCCCGCTTGGACAATATAAAGCCTCCTCCTCGGCGGGATGCCTGATTGGCAGTATCCTTCCTAG
CCAAACATAGCCAGCATCCACAACTCTACATGATGGGTGGAAGAACTGAGTCATTGTTATCGGACACGAAGAACGACATGTTTCGAAATGCATCCATGCT
ATTTTCCATCATCCGACTCCAACTATTTTGACTGTCTCCTAAGATGAACTCATCAGCTAGGGATCTTATTGGTGGTATATCCAAGTCCAGTGGTCCAAGT
GATTCGGGCCAGAATACGTCATCTAGAGGCTGATCTTTCAATCCAAAATCATTGTCACTTTGAGGTGGTGATCTGGCACAAAGTTCTTCCATTGCCTTCA
CATCATCAGCACAAGGATTACCAGGAGTATCTCCTCCAGCCAAGTCCTGAAGAAAACCTTGAAACCCTTCTGAATTTGAAGAGTGAACTTCATTGTCGCT
ATCAGGAGGGCTGCTAGCTGAAGTGTTTAAACCTTGTTGCTTCCTAGCTGTGGCCAACATAAAACTGAACTCATCACATGTTTCTTCTGCACCCCAGATG
GTGGAATTGGATGTATGAGCTGGCTGCTCTGCTGCTTGATAACGAGAAGCATGTAGGGCAACAGCAGCATCAAACGAGTCATAGCTGCACGGATTCTCAT
CGAAAAGAGGATTTTGGGCAATAGAGGTCACTTCACAATCCAAATTAGCAGCCTTGGATGCTTCTGTCAGCAAGTATCCAACACTGATATCAGTAAGGGT
ATCTGCCCAATCTACTTCCGATATTGCAAGACAATCCATCTGAGGATCAACCTCAAAAGCTTTGTTTGCAGGAACTTGTTCTTGATTGTGATCGCCAG
page-top