Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33286  (registered. 2012)
Contig Information
Length 1196 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 4
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XN Leaves, plant was grown at constant 23 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456699|ref|NP_001051950.1|| Os03g0856500 [Oryza sativa (japonica cultivar-group)]
Score 355
Evalue 8.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33286
CTTCTCCGCTGGAGCTGCTGCTGCCAAAGTTTGTGTCTTTCTCTCTGTCCGTCCAGTAGATGAGCATGGCGGCGACGGCGGCCACGGCCACGGCGTGGCC
CTCCACCTCCTCCTCTGTCCTCGCCCCCCGCACCCGCCACCACGTCACTCCCAGCCCCCGCGCCCTCCGCTCCGGCTTCCTCGGCCGCGCCCTCACCCTG
GCCGCCGCCACCGACCGCCCCTCCTCCGTCTCCATCTCCGTGCGCGCGGCCTGGGACGGGCCGCTCTCCTCGGCGCGCCTCATCATGCAGGGCCGCAACG
TCAAGCTGACGGAGAAGCTCAAGGAGCACATCGAGGACAAGGTGGGGCGCGCGGTGCACAACCACGCGCACCTGGTGCGGGAGGTGGACGTGCGCCTCTC
CGCCCGCGGCGGCGACCTCAGCAAGGGCCCCAAGCTCTCCCGCTGCGAGGTCACGCTCTTCACCAGGCGCCACGGCGTCGTGCGCGCCGAGGAGGAGGAG
GAGTCATCCTACGCCTCCATCGACGCCGCCGCCGCCGTCGTCAAGCGCAAGCTGCGCAAGATCAAGGAGAAGGAGACGGACGTGCGCCACCTCAAGGGCA
CCAAGGAGTGGCAGTCCTCCGGGCTGTCCGATGTCGAAGATGAATCGGAGGCAGAGGAGGAGGAGGAGGACGACGAGCTGGTCGAGGTCATCGGCGCCGA
GGACGAGGAGAGCGTGCTCACCAAGGTTGTGCGCACCAAGGTGTTCGAGATGGCGCCGCTGACGGTGGACGAGGCGCTGGAGCAGCTCGAGAACGTCGAC
CATGACTTCTACGCCTTCAGGAACGAGCAGACAGGGGAGGTGAACATCCTGTACAAGAGGAATGAGGGAGGGTTTGGGCTCATCATCCCCAAGCAGGACG
GCCACGTCGACAAGGCCACCGTCAATGCCAAGGAGAAGGAGCACCCCGTCGCCGGCTGACCATGGCACCAAGTCACTCACTAGCTGTAGCTGCATTAGTC
GGTCTGTTTTTTCCCTGATGATGGTGGTGGGTGTGGTGTTTCATCAGATCAGACCAGACAGTCCCTCCCTTCTCCCTTGTGCAAATTAACAGACGCTTTC
TGAGCTGTGTTAACTCATGATGATCCCACACACACACACCAGTTGGTAAGTTTTTTCAGAAGTGATTAAGTAATCAGTAATCGCCTAAAAAAAAAA
page-top