Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig33247  (registered. 2012)
Contig Information
Length 1679 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_SH - 3
Wh_DPA20 Seed DPA20 4
Wh_RDr Root of dessiccated seed 3
Wh_VSCB Liquid cultured tissue 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|111073719|dbj|BAF02548.1|| triticain gamma [Triticum aestivum]
Score 734
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig33247
CCCGATCCGGCCCGTCACCGAGCGCGCCGCTTCGACGCTCGAGTCCACCGTCCTCGCCGCGCTCGGCCGCACCCGCCACGCCCTCCGCTTCGCGCGCTTC
GCCGTCAGGTACGGCAAGAGCTACGAGAGCGCGGCGGAGGTGCGGAGGCGGTTCCGGATCTTCTCCGAGAGCCTCGAGGAGGTGCGCTCCACCAACCGGA
AGGGCCTATCCTACCGCCGGCGAAATGGCCCACGCCCGCATCCTCCTCCTGGCGCTCGCCGCCCTGGCCACGGCCACCGTCGCCGTCGCCTCCTCCTCCT
CCTCCTCCTCCTTCGCCGTCTCCAACCCGATCCGGCCCGTCACCGAGCGCGCCGCTTCGACGCTCGAGTCCACCGTCCTCGCCGCGCTCGGCCGCACCCG
CCACGCCCTCCGCTTCGCGCGCTTCGCCGTCAGGTACGGCAAGAGCTACGAGAGCGCGGCGGAGGTGCGGAGGCGGTTCCGGATCTTCTCCGAGAGCCTC
GAGGAGGTGCGCTCCACCAACCGGAAGGGCCTATCCTACCGCCTCGGCATCAACCGCTTCTCGGACATGAGCTGGGAGGAGTTCCAGGCGACCCGGCTCG
GCGCGGCGCAGACCTGCTCGGCCACGCTCGCCGGCAACCACCTGATGCGCGACGCCGCCGCGCTCCCGGAGACCAAAGACTGGAGGGAGGATGGGATCGT
TAGCCCCGTAAAAGACCAGTCCCATTGCGGCTCCTGCTGGACGTTCAGCACTACTGGTGCACTTGAGGCAGCATATACTCAGGCCACTGGAAAGAACATC
TCTCTTTCTGAGCAACAGCTGGTTGACTGTGCCGGCGGATTCAATAATTTCGGATGCAGCGGAGGCCTTCCATCCCAGGCATTTGAGTACATCAAATACA
ATGGAGGGATCGATACCGAGGAGTCCTACCCTTACAAGGGTGTCAATGGCGTCTGCCATTACAAGGCTGAAAATGCCGTAGTTCAGGTTTTGGACTCTGT
TAACATCACACTGAATGCTGAGGACGAACTGAAAAACGCCGTCGGGTTGGTTCGCCCAGTGAGTGTTGCCTTTGAGGTGATCAACGGTTTCAGGCAGTAC
AAGAGCGGAGTTTACAGTAGCGACCATTGCGGTACTACACCTGATGACGTGAACCACGCCGTCTTGGCGGTCGGGTACGGCGTGGAGAACGGCGTCCCGT
ATTGGCTCATCAAGAACTCGTGGGGCGCCGACTGGGGTGACAATGGTTACTTCAAGATGGAAATGGGCAAGAACATGTGTGCTGTTGCTACCTGTGCGTC
CTACCCCATCGTAGCGGCATGAAGCGCCAAATCGACGAGTTCAGTCTCGCTTCGCTAGACATGAATAATGTGTTTTCAGCCCACAAGACATGAAGATTGG
GGGATACAGAAACTGAAACTCTGCTGTGAATATAAAACCACAAGGACTACAGTTGCAGTGAACCACGTGCGTGTACTCTTCTTCTGTATGGTTGTATGGC
TATATATGTAGGTGATACAGCAATTTATTGGGGTTTCGCATGTATGTCTACGACATTTTATTTCCGGGACAAATAAAATGGCCCATTCATAGTTCAAAAA
AAAATCAAAAAAATGTTGATACTAGCAGGAAATTGCATGCCACACATGAATATTGCCATATACTTAGGGTTCATTCCGT
page-top